WormBase Tree Display for Variation: WBVar00250255
expand all nodes | collapse all nodes | view schema
WBVar00250255 | Name | Public_name | tm1247 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | C05E11.1b.1:c.276_812+5del | |||||||
C05E11.1a.1:c.276_812+5del | ||||||||
HGVSg | CHROMOSOME_X:g.4589092_4589928del | |||||||
Sequence_details | SMap | S_parent | Sequence | C05E11 | ||||
Flanking_sequences | tcttgctggtcgctacgtgattaacggatt | tttctctcaaaagttccagaaatagttttg | ||||||
Mapping_target | C05E11 | |||||||
Source_location | 7 | CHROMOSOME_X | 4589091 | 4589929 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product | tm1247_external | |||||||
tm1247_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 1247 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00015492 | ||||||
Transcript | C05E11.1a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | C05E11.1a.1:c.276_812+5del | |||||||
cDNA_position | 276-? | |||||||
CDS_position | 276-? | |||||||
Protein_position | 92-? | |||||||
Intron_number | 2-5/6 | |||||||
Exon_number | 2-5/7 | |||||||
C05E11.1b.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | C05E11.1b.1:c.276_812+5del | |||||||
cDNA_position | 282-? | |||||||
CDS_position | 276-? | |||||||
Protein_position | 92-? | |||||||
Intron_number | 3-6/7 | |||||||
Exon_number | 3-6/8 | |||||||
Interactor | WBInteraction000503497 | |||||||
WBInteraction000503498 | ||||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | X | ||||||
Description | Phenotype | WBPhenotype:0000478 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from Dr. I. Mori to the National Bioresource Project of Japan: weakly abnormal thermotaxis (raised at 23 C). | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | FX | |||||||
Phenotype_not_observed | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as homozygous viable by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | FX | |||||||
Remark | 33516/33517-34353/34354 (837 bp deletion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |