WormBase Tree Display for Variation: WBVar00250190

WBVar00250190 Name: Public_name: tm1178
    Other_name: CE29634:p.Ala78ProfsTer46
      ZK1248.16.1:c.231_576del
    HGVSg: CHROMOSOME_II:g.5840170_5840818del
  Sequence_details: SMap: S_parent: Sequence: ZK1248
    Flanking_sequences: agcagaaatatccagtctctttcctggggt gatcctttgtggaagttaaaatccacacga
    Mapping_target: ZK1248
    Source_location: 7 CHROMOSOME_II 5840169 5840819 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm1178_external
      tm1178_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 1178
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00002268
    Transcript: ZK1248.16.1 (11)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: II
  Description: Phenotype_not_observed: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as homozygous viable by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000315 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. M. Chalfie to the National Bioresource Project of Japan: normal touch sensitivity. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Remark: 30648/30649-31297/31298 (649 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele