WormBase Tree Display for Variation: WBVar00250171

WBVar00250171 Name: Public_name: tm1156
    Other_name: CE15691:p.Lys72_Ter184delextTer?
      Y66A7A.6.1:c.213_551del
    HGVSg: CHROMOSOME_III:g.11625796_11626733del
  Sequence_details: SMap: S_parent: Sequence: Y66A7AR
    Flanking_sequences: ccaggaatccaagaaatccgaatggggaat ccgagcaaaggttcatgcttcaagattagc
    Mapping_target: Y66A7AR
    Source_location: 7 CHROMOSOME_III 11625795 11626734 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm1156_external
      tm1156_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 1156
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00001633
    Transcript: Y66A7A.6.1 (11)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: III
    Mapping_data: In_multi_point: 5114
  Description: Phenotype_not_observed: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Classified as homozygous viable by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
            Laboratory_evidence: FX
  Remark: [Y66A7AR] 15318/15319-[Y66A7AR] 16256/16257 (938 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele