WormBase Tree Display for Variation: WBVar00249801

WBVar00249801 Name: Public_name: tm773
    HGVSg: CHROMOSOME_V:g.10564672_10565321del
  Sequence_details: SMap: S_parent: Sequence: F32G8
    Flanking_sequences: tcattttgcctattttttcccagaatacct aatataaatttgaccaagatgttttgaaag
    Mapping_target: F32G8
    Source_location: 7 CHROMOSOME_V 10564671 10565322 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm773_external
      tm773_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00024116
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 773
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00000298
    Transcript: F32G8.6.1 VEP_consequence: splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant
        VEP_impact: HIGH
        Intron_number: 2/5
        Exon_number: 1-2/6
  Isolation: Mutagen: TMP/UV
  Genetics: Map: V
  Description: Phenotype_not_observed: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as homozygous viable by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Remark: 17232/17233-17882/17883 (650 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele