WormBase Tree Display for Variation: WBVar00249778

WBVar00249778 Name: Public_name: tm749
    HGVSg: CHROMOSOME_II:g.10785351_10786087delinsGAAAAATGAA
  Sequence_details: SMap: S_parent: Sequence: R06F6
    Flanking_sequences: gtttccatttgaaatgtgaataattcttat taatgaaggtgcatcaccttcaaaacgtcg
    Mapping_target: R06F6
    Source_location: 7 CHROMOSOME_II 10785350 10786088 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Insertion: GAAAAATGAA
      Deletion
    PCR_product: tm749_external
      tm749_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 749
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00000411
    Transcript: R06F6.1.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant
        VEP_impact: HIGH
        cDNA_position: ?-517
        CDS_position: ?-500
        Protein_position: ?-167
        Intron_number: 2-3/6
        Exon_number: 1-4/7
  Isolation: Mutagen: TMP/UV
  Genetics: Map: II
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
  Remark: 112/113-GAAAAATGAA-849/850 (737 bp deletion + 10 bp insertion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele