WormBase Tree Display for Variation: WBVar00249691

WBVar00249691 Name: Public_name: tm659
    Other_name: C41C4.8.1:c.1374+25_1985del
    HGVSg: CHROMOSOME_II:g.8140003_8140641del
  Sequence_details: SMap: S_parent: Sequence: F10B5
    Flanking_sequences: tttagagtaagttatcatttttttgcactt caaggcctcactccgcaaaacgcccctttc
    Mapping_target: F10B5
    Source_location: 7 CHROMOSOME_II 8140002 8140642 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm659_external
      tm659_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00007566
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 659
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00008053
    Transcript: C41C4.8.1 VEP_consequence: splice_acceptor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: C41C4.8.1:c.1374+25_1985del
        cDNA_position: ?-2000
        CDS_position: ?-1985
        Protein_position: ?-662
        Intron_number: 4/6
        Exon_number: 5/7
    Interactor (210)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: II
    Mapping_data: In_multi_point: 5088
  Description: Phenotype: WBPhenotype:0000154 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comments to the National Bioresource Project of Japan: Dr. T. Schedl: smaller brood size (180-200/mom). Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: BS
      WBPhenotype:0001645 Paper_evidence: WBPaper00059773
        Curator_confirmed: WBPerson2876
        Remark: Figure S7 Paper_evidence: WBPaper00059773
            Curator_confirmed: WBPerson2876
    Phenotype_not_observed: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as homozygous viable by the National Bioresource Project of Japan. Comments to the NBP from Dr. T. Ogura: BBRC 345, 746-753 (2006); Genes to Cells: 12, 1063 (2007); Dr. T. Hoppe: J. Struct. Biol. 156, 41 (2006), Nat. Cell Biol. 9, 379 (2007). Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000633 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. A. Colavita to the National Bioresource Project of Japan: no VC neuron axon branching defects. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: OU
        EQ_annotations: Anatomy_term: WBbt:0005304 PATO:0000460 Person_evidence: WBPerson7743
                Curator_confirmed: WBPerson712
      WBPhenotype:0000812 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comments to the National Bioresource Project of Japan: Dr. T. Schedl: no germline phenotype. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: BS
      WBPhenotype:0001236 Paper_evidence: WBPaper00030999
        Curator_confirmed: WBPerson2987
        Remark: "Although either cdc-48.1(tm544) or cdc-48.2(tm659) did not induce the hsp-4::gfp expression (Fig. 1B), the hsp-4::gfp expression was clearly induced especially in intestine when both p97 were depleted simultaneously (Fig. 1C,D; Supplementary Fig. S1), implying that their simultaneous depletion induces UPR." Paper_evidence: WBPaper00030999
            Curator_confirmed: WBPerson2987
        Phenotype_assay: Genotype: hsp-4::gfp Paper_evidence: WBPaper00030999
              Curator_confirmed: WBPerson2987
      WBPhenotype:0001429 Paper_evidence: WBPaper00030999
        Curator_confirmed: WBPerson2987
        Remark: "As shown in Fig. 1A, dark staining large intestinal granules were observed in p97-depleted worms, while such granules were not observed in control worms. Note that single deletion mutant, either cdc-48.1(tm544) or cdc-48.2(tm659), did not cause such granules (data not shown)." Paper_evidence: WBPaper00030999
            Curator_confirmed: WBPerson2987
        EQ_annotations: Anatomy_term: WBbt:0005772 PATO:0000460 Paper_evidence: WBPaper00030999
                Curator_confirmed: WBPerson2987
  Reference: WBPaper00030999
    WBPaper00059773
  Remark: [F10B5] 879/880-[F10B5] 1518/1519 (639 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele