WormBase Tree Display for Variation: WBVar00249498

WBVar00249498 Name: Public_name: tm452
    Other_name: F20D12.6b.1:c.238+399_437+322del
    HGVSg: CHROMOSOME_IV:g.7954178_7955169del
  Sequence_details: SMap: S_parent: Sequence: F20D12
    Flanking_sequences: aaatatgttttgatttttctccgtttttca aaacgttactattacgtggacgtctaaata
    Mapping_target: F20D12
    Source_location: 7 CHROMOSOME_IV 7954177 7955170 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm452_external
      tm452_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 452
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00000442
    Transcript: F20D12.6a.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant
        VEP_impact: HIGH
        Intron_number: 2-4/5
        Exon_number: 1-4/6
      F20D12.6b.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: F20D12.6b.1:c.238+399_437+322del
        Intron_number: 2-4/5
        Exon_number: 3-4/6
    Interactor: WBInteraction000519415
  Isolation: Mutagen: TMP/UV
  Genetics: Map: IV
  Description: Phenotype: WBPhenotype:0000019 Paper_evidence: WBPaper00041911
        Curator_confirmed: WBPerson266
        Remark: Closer examination of pumping behavior indicated that pharyngeal pumping rate of ceh-19(n452) mutants was indeed reduced by more than 30% compared to N2 animals (Fig. 5a). In N2 individuals the pharynx pumped 239 +/- 48.5 times per minute (mean +/- s.d.) compared to 148 +/- 30 times per minute for ceh-19(n452) mutants. Paper_evidence: WBPaper00041911
            Curator_confirmed: WBPerson266
    Phenotype_not_observed: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as homozygous viable by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Reference: WBPaper00041911
  Remark: 22165/22166-23157/23158 (992 bp deletion )
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele