WormBase Tree Display for Variation: WBVar00249451
expand all nodes | collapse all nodes | view schema
WBVar00249451 | Name | Public_name | tm403 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | C09B8.7a.1:c.82-63_723+81delinsGATGCATGTGTTGCT | |||||||
C09B8.7b.1:c.82-63_714+81delinsGATGCATGTGTTGCT | ||||||||
HGVSg | CHROMOSOME_X:g.6046948_6048421delinsAGCAACACATGCATC | |||||||
Sequence_details | SMap | S_parent | Sequence | C45B2 | ||||
Flanking_sequences | ttcctaaacctagaaataaaaaatgtggta | aggggcaagcaacacatgcatcatctgatt | ||||||
Mapping_target | C45B2 | |||||||
Source_location | 7 | CHROMOSOME_X | 6046947 | 6048422 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Insertion | agcaacacatgcatc | ||||||
Deletion | ||||||||
PCR_product | tm403_external | |||||||
tm403_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 403 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00003911 | ||||||
WBGene00196764 | ||||||||
Transcript | C09B8.7c.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
Intron_number | 1-5/9 | |||||||
Exon_number | 1-5/10 | |||||||
C09B8.7b.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | C09B8.7b.1:c.82-63_714+81delinsGATGCATGTGTTGCT | |||||||
Intron_number | 2-7/12 | |||||||
Exon_number | 3-7/13 | |||||||
C09B8.7a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | C09B8.7a.1:c.82-63_723+81delinsGATGCATGTGTTGCT | |||||||
Intron_number | 2-7/12 | |||||||
Exon_number | 3-7/13 | |||||||
C45B2.10 | VEP_consequence | non_coding_transcript_exon_variant | ||||||
VEP_impact | MODIFIER | |||||||
cDNA_position | 69-? | |||||||
Exon_number | 1/1 | |||||||
Interactor | WBInteraction000518804 | |||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | X | ||||||
Description | Phenotype | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as lethal OR sterile by the National Bioresource Project of Japan. Comment from Dr. Y. Jin: could not maintain as homozygote. Comment to the NBP from Dr. M. Labouesse: Development 136, 3109 (2009). | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | FX | |||||||
CZ | ||||||||
ML | ||||||||
WBPhenotype:0000531 | Paper_evidence | WBPaper00038193 | ||||||
Curator_confirmed | WBPerson351 | |||||||
Remark | Young L1 larvae are slightly short and have a head bump, which disappears by the middle of L1. The phenotype is not easy to spot | Paper_evidence | WBPaper00038193 | |||||
Curator_confirmed | WBPerson351 | |||||||
Temperature_sensitive | Cold_sensitive | Paper_evidence | WBPaper00038193 | |||||
Curator_confirmed | WBPerson351 | |||||||
WBPhenotype:0000688 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as lethal OR sterile by the National Bioresource Project of Japan. Comments to the NBP from Dr. Y. Jin: could not maintain as homozygote; Dr. M. Labouesse: Development 136, 3109 (2009). | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | FX | |||||||
CZ | ||||||||
Reference | WBPaper00038193 | |||||||
Remark | 41185/41186-agcaacacatgcatc-42659/42660 (1474 bp deletion, 15 bp addition) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Old Mapping_target C09B8 updated based on the VEP analysis pipeline to C45B2. | ||||||||
Method | NBP_knockout_allele |