WormBase Tree Display for Variation: WBVar00249019
expand all nodes | collapse all nodes | view schema
WBVar00249019 | Evidence | Paper_evidence | WBPaper00005610 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | sy607 | |||||||
HGVSg | CHROMOSOME_II:g.14902263_14903510del | ||||||||
Sequence_details | SMap | S_parent | Sequence | R03C1 | |||||
Flanking_sequences | ttaagttttggaaaattacaacaaaaaaaa | caaactattggaaatattacaagctatttt | |||||||
Mapping_target | R03C1 | ||||||||
Type_of_mutation | Deletion | ||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00030887 | ||||||||
Laboratory | PS | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00201367 | |||||||
WBGene00000584 | |||||||||
Transcript (3) | |||||||||
Interactor (12) | |||||||||
Genetics | Interpolated_map_position | II | 23.6939 | ||||||
Description | Phenotype | WBPhenotype:0000154 | Paper_evidence | WBPaper00005610 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00005610 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00005610 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000239 | Paper_evidence | WBPaper00005610 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | vulC precursors fail to divide | Paper_evidence | WBPaper00005610 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00005610 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations (2) | |||||||||
WBPhenotype:0000399 | Paper_evidence | WBPaper00005610 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | spermathecal-uterine junction core is missing | Paper_evidence | WBPaper00005610 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00005610 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations (2) | |||||||||
WBPhenotype:0001376 | Paper_evidence | WBPaper00025135 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "In contrast, cog-1(sy607) caused loss of cdh-3 expression in vulC, vulD, and vulE cells and loss of ceh-2 expression in vulB." | Paper_evidence | WBPaper00025135 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations (2) | |||||||||
Phenotype_assay | Genotype | syIs50 [cdh-3::gfp] | Paper_evidence | WBPaper00025135 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
syIs54 [ceh-2::gfp] | Paper_evidence | WBPaper00025135 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001660 | Paper_evidence | WBPaper00006052 | |||||||
WBPaper00044621 | |||||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPerson6538 | |||||||||
Remark | ASE asymmetry is disrupted (as seen with lim-6 reporters). 2 ASEL | Paper_evidence | WBPaper00006052 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Fig 3A. Loss of ASE asymmetry | Paper_evidence | WBPaper00044621 | |||||||
Curator_confirmed | WBPerson6538 | ||||||||
Penetrance | High | Paper_evidence | WBPaper00044621 | ||||||
Curator_confirmed | WBPerson6538 | ||||||||
Complete | Paper_evidence | WBPaper00006052 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Predicted_null_via_sequence | Paper_evidence | WBPaper00044621 | ||||||
Curator_confirmed | WBPerson6538 | ||||||||
EQ_annotations (2) | |||||||||
Phenotype_assay | Genotype | otIs6, otIs114 | Paper_evidence | WBPaper00006052 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference | WBPaper00006052 | ||||||||
WBPaper00025135 | |||||||||
WBPaper00017759 | |||||||||
WBPaper00005610 | |||||||||
WBPaper00044621 | |||||||||
Method | Deletion_allele |