WormBase Tree Display for Variation: WBVar00242487
expand all nodes | collapse all nodes | view schema
WBVar00242487 | Evidence | Paper_evidence | WBPaper00003219 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | sa96 | ||||||
Other_name | CE27118:p.Gly288Arg | |||||||
F02D10.5.1:c.862G>A | ||||||||
HGVSg | CHROMOSOME_X:g.13454449C>T | |||||||
Sequence_details | SMap | S_parent | Sequence | F02D10 | ||||
Flanking_sequences | cagatatctctcctagacaaagcaaattgg | gatcctgctcaaaagggtggaatagaaatg | ||||||
Mapping_target | F02D10 | |||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00003219 | |||
Person_evidence | WBPerson309 | |||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | JT | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00001465 | ||||||
Transcript | F02D10.5.1 (12) | |||||||
Genetics | Interpolated_map_position | X | 12.5744 | |||||
Mapping_data | In_multi_point | 3255 | ||||||
3256 | ||||||||
3257 | ||||||||
Description | Phenotype | WBPhenotype:0000031 | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | slow growing | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000209 | Paper_evidence | WBPaper00002315 | ||||||
Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | The best fit mean cycle time was 15.2 sec as calculated by MESA. | Paper_evidence | WBPaper00002315 | |||||
Curator_confirmed | WBPerson712 | |||||||
very short defecation cycle period | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Recessive | Paper_evidence | WBPaper00002315 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Temperature | 20, 25 | Paper_evidence | WBPaper00002315 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000314 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000380 | Paper_evidence | WBPaper00002315 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | The Exp step was activated less frequently, corresponding to shorter cycle periods. | Paper_evidence | WBPaper00002315 | |||||
Curator_confirmed | WBPerson712 | |||||||
Recessive | Paper_evidence | WBPaper00002315 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Temperature | 20, 25 | Paper_evidence | WBPaper00002315 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000391 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | often with weak or missing motor program steps | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000651 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Con | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001641 | Paper_evidence | WBPaper00002315 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | pBocs were noticibly weaker with the shortened cycle periods. | Paper_evidence | WBPaper00002315 | |||||
Curator_confirmed | WBPerson712 | |||||||
Recessive | Paper_evidence | WBPaper00002315 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Temperature | 20, 25 | Paper_evidence | WBPaper00002315 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001855 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_not_observed | WBPhenotype:0000659 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | appears to feed normally | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001791 | Paper_evidence | WBPaper00002315 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | The defecation cycle was equally altered at 20C and 25C. | Paper_evidence | WBPaper00002315 | |||||
Curator_confirmed | WBPerson712 | |||||||
Recessive | Paper_evidence | WBPaper00002315 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Temperature | 20, 25 | Paper_evidence | WBPaper00002315 | ||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00002315 | |||||||
Method | Substitution_allele |