WormBase Tree Display for Variation: WBVar00242460
expand all nodes | collapse all nodes | view schema
WBVar00242460 | Evidence | Paper_evidence | WBPaper00032261 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | sa22 | |||||
Other_name | T14G12.2.1:c.24-1G>A | ||||||
HGVSg | CHROMOSOME_X:g.3729461G>A | ||||||
Sequence_details | SMap | S_parent | Sequence | T14G12 | |||
Flanking_sequences | ataaataaatcattactccaactttttgca | aattccagagccaattgctcttccaacaga | |||||
Mapping_target | T14G12 | ||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00032261 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain | WBStrain00022822 | ||||||
Laboratory | JT | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00006454 | |||||
Transcript | T14G12.2.1 | VEP_consequence | splice_acceptor_variant | ||||
VEP_impact | HIGH | ||||||
HGVSc | T14G12.2.1:c.24-1G>A | ||||||
Intron_number | 2/9 | ||||||
Interactor | WBInteraction000524187 | ||||||
Genetics | Interpolated_map_position | X | -9.69193 | ||||
Mapping_data | In_multi_point | 1551 | |||||
1588 | |||||||
2291 | |||||||
Description | Phenotype | WBPhenotype:0000650 | Person_evidence | WBPerson261 | |||
Curator_confirmed | WBPerson712 | ||||||
Remark | defecation defective | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0000651 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | moderately constipated | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0001793 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | anterior body contraction (aBoc) and expulsion muscle contraction (Exp) missing in about 6 of 7 defecation cycles, adult males unaffected and mate well. | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||
Reference | WBPaper00032261 | ||||||
Method | Substitution_allele |