WormBase Tree Display for Variation: WBVar00241696
expand all nodes | collapse all nodes | view schema
WBVar00241696 | Evidence | Paper_evidence | WBPaper00045431 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | s71 | |||||||
Other_name | CE09631:p.Leu281Ter | ||||||||
CE43409:p.Leu281Ter | |||||||||
F25D7.3b.1:c.842T>A | |||||||||
F25D7.3a.1:c.842T>A | |||||||||
HGVSg | CHROMOSOME_I:g.10410794T>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | F25D7 | |||||
Flanking_sequences | cagcttctgcatcaactgcaattgcgagtt | agcagaaacaattgtggcaattgattattca | |||||||
Mapping_target | F25D7 | ||||||||
Type_of_mutation | Substitution | t | r | Paper_evidence | WBPaper00045431 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00000464 | ||||||||
WBStrain00022557 | |||||||||
WBStrain00034109 | |||||||||
WBStrain00034369 | |||||||||
Laboratory | BC | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00003847 | |||||||
Transcript | F25D7.3b.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | F25D7.3b.1:c.842T>A | ||||||||
HGVSp | CE43409:p.Leu281Ter | ||||||||
cDNA_position | 899 | ||||||||
CDS_position | 842 | ||||||||
Protein_position | 281 | ||||||||
Exon_number | 4/9 | ||||||||
Codon_change | tTa/tAa | ||||||||
Amino_acid_change | L/* | ||||||||
F25D7.3a.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | F25D7.3a.1:c.842T>A | ||||||||
HGVSp | CE09631:p.Leu281Ter | ||||||||
cDNA_position | 899 | ||||||||
CDS_position | 842 | ||||||||
Protein_position | 281 | ||||||||
Exon_number | 4/10 | ||||||||
Codon_change | tTa/tAa | ||||||||
Amino_acid_change | L/* | ||||||||
Interactor | WBInteraction000523861 | ||||||||
Genetics | Interpolated_map_position | I | 4.98456 | ||||||
Mapping_data | In_2_point | 464 | |||||||
5839 | |||||||||
6048 | |||||||||
In_multi_point (14) | |||||||||
In_pos_neg_data | 2512 | ||||||||
5841 | |||||||||
5843 | |||||||||
5845 | |||||||||
5847 | |||||||||
8063 | |||||||||
8074 | |||||||||
8085 | |||||||||
Description | Phenotype | WBPhenotype:0000050 | Paper_evidence | WBPaper00045431 | |||||
Curator_confirmed | WBPerson703 | ||||||||
Remark | partial penetrance | Paper_evidence | WBPaper00045431 | ||||||
Curator_confirmed | WBPerson703 | ||||||||
WBPhenotype:0000195 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | abnormal DTC migration | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000583 | Paper_evidence | WBPaper00000427 | |||||||
WBPaper00045431 | |||||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPerson703 | |||||||||
Remark | Weak dumpy, easy to score (ES3) in adult, very hard to score in larvae (ES1). | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00000427 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Ease_of_scoring | ES3_Easy_to_score | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001412 | Paper_evidence | WBPaper00045431 | |||||||
Curator_confirmed | WBPerson703 | ||||||||
WBPhenotype:0001494 | Paper_evidence | WBPaper00045431 | |||||||
Curator_confirmed | WBPerson703 | ||||||||
WBPhenotype:0001801 | Paper_evidence | WBPaper00056872 | |||||||
Curator_confirmed | WBPerson26767 | ||||||||
Remark | axodendritic polarity of DA9 neuron variant | Paper_evidence | WBPaper00056872 | ||||||
Curator_confirmed | WBPerson26767 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004857 | PATO:0000460 | Paper_evidence | WBPaper00056872 | ||||
Curator_confirmed | WBPerson26767 | ||||||||
Phenotype_assay | Genotype | wyIs85 [Pitr-1-pB::GFP::RAB-3] | Paper_evidence | WBPaper00056872 | |||||
Curator_confirmed | WBPerson26767 | ||||||||
Phenotype_not_observed (2) | |||||||||
Reference | WBPaper00000427 | ||||||||
WBPaper00001328 | |||||||||
WBPaper00004883 | |||||||||
WBPaper00045431 | |||||||||
WBPaper00056872 | |||||||||
Remark | This was previously annotated as a ta -> rr, this was not correct as tta -> taa (Ochre) or tta -> tga (Opal) can be achieved with a single bp mutation as the original annotation assumed. | ||||||||
Method | Substitution_allele |