WormBase Tree Display for Variation: WBVar00241696
expand all nodes | collapse all nodes | view schema
| WBVar00241696 | Evidence | Paper_evidence | WBPaper00045431 | ||||
|---|---|---|---|---|---|---|---|
| Name | Public_name | s71 | |||||
| Other_name | CE09631:p.Leu281Ter | ||||||
| CE43409:p.Leu281Ter | |||||||
| F25D7.3b.1:c.842T>A | |||||||
| F25D7.3a.1:c.842T>A | |||||||
| HGVSg | CHROMOSOME_I:g.10410794T>A | ||||||
| Sequence_details | SMap | S_parent | Sequence | F25D7 | |||
| Flanking_sequences | cagcttctgcatcaactgcaattgcgagtt | agcagaaacaattgtggcaattgattattca | |||||
| Mapping_target | F25D7 | ||||||
| Type_of_mutation | Substitution | t | r | Paper_evidence | WBPaper00045431 | ||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Strain | WBStrain00000464 | ||||||
| WBStrain00022557 | |||||||
| WBStrain00034109 | |||||||
| WBStrain00034369 | |||||||
| Laboratory | BC | ||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00003847 | |||||
| Transcript | F25D7.3b.1 | VEP_consequence | stop_gained | ||||
| VEP_impact | HIGH | ||||||
| HGVSc | F25D7.3b.1:c.842T>A | ||||||
| HGVSp | CE43409:p.Leu281Ter | ||||||
| cDNA_position | 899 | ||||||
| CDS_position | 842 | ||||||
| Protein_position | 281 | ||||||
| Exon_number | 4/9 | ||||||
| Codon_change | tTa/tAa | ||||||
| Amino_acid_change | L/* | ||||||
| F25D7.3a.1 | VEP_consequence | stop_gained | |||||
| VEP_impact | HIGH | ||||||
| HGVSc | F25D7.3a.1:c.842T>A | ||||||
| HGVSp | CE09631:p.Leu281Ter | ||||||
| cDNA_position | 899 | ||||||
| CDS_position | 842 | ||||||
| Protein_position | 281 | ||||||
| Exon_number | 4/10 | ||||||
| Codon_change | tTa/tAa | ||||||
| Amino_acid_change | L/* | ||||||
| Interactor | WBInteraction000523861 | ||||||
| Genetics | Interpolated_map_position | I | 4.98456 | ||||
| Mapping_data | In_2_point | 464 | |||||
| 5839 | |||||||
| 6048 | |||||||
| In_multi_point (14) | |||||||
| In_pos_neg_data | 2512 | ||||||
| 5841 | |||||||
| 5843 | |||||||
| 5845 | |||||||
| 5847 | |||||||
| 8063 | |||||||
| 8074 | |||||||
| 8085 | |||||||
| Description (2) | |||||||
| Reference | WBPaper00000427 | ||||||
| WBPaper00001328 | |||||||
| WBPaper00004883 | |||||||
| WBPaper00045431 | |||||||
| WBPaper00056872 | |||||||
| Remark | This was previously annotated as a ta -> rr, this was not correct as tta -> taa (Ochre) or tta -> tga (Opal) can be achieved with a single bp mutation as the original annotation assumed. | ||||||
| Method | Substitution_allele |
