WormBase Tree Display for Variation: WBVar00241650
expand all nodes | collapse all nodes | view schema
WBVar00241650 | Name (3) | ||||||||
---|---|---|---|---|---|---|---|---|---|
Sequence_details | SMap | S_parent | Sequence | F31B12 | |||||
Flanking_sequences | gcgtttggttaaattgcttcaagcgggtgc | ttggcacttggatacgtacgaatcagctga | |||||||
Mapping_target | F31B12 | ||||||||
Type_of_mutation | Deletion | ||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00030933 | ||||||||
Laboratory | KF | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00004036 | |||||||
Transcript (12) | |||||||||
Interactor | WBInteraction000521593 | ||||||||
Genetics | Interpolated_map_position | X | 2.53561 | ||||||
Description | Phenotype | WBPhenotype:0000154 | Paper_evidence | WBPaper00042394 | |||||
Curator_confirmed | WBPerson1777 | ||||||||
WBPhenotype:0000666 | Paper_evidence | WBPaper00042394 | |||||||
Curator_confirmed | WBPerson1777 | ||||||||
Remark | Embryos are retained in the spermatheca and fail to exit into the uterus following fertilization. | Paper_evidence | WBPaper00042394 | ||||||
Curator_confirmed | WBPerson1777 | ||||||||
Fail to produce calcium signals following oocyte entry into the spermatheca. Do not produce initial pulse of calcium in the sp-ut valve during ovulation. | Paper_evidence | WBPaper00042394 | |||||||
Curator_confirmed | WBPerson1777 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006756 | PATO:0000460 | Paper_evidence | WBPaper00042394 | ||||
Curator_confirmed | WBPerson1777 | ||||||||
WBbt:0005319 | PATO:0000460 | Paper_evidence | WBPaper00042394 | ||||||
Curator_confirmed | WBPerson1777 | ||||||||
GO_term | GO:0030728 | PATO:0000460 | Paper_evidence | WBPaper00042394 | |||||
Curator_confirmed | WBPerson1777 | ||||||||
Reference | WBPaper00042394 | ||||||||
Remark | This deletion removes 45% of the genomic region of the Y domain and the entire C2 and RA1 domains. | Paper_evidence | WBPaper00024374 | ||||||
Method | Deletion_allele |