WormBase Tree Display for Variation: WBVar00241627

WBVar00241627 Evidence: Paper_evidence: WBPaper00031692
  Name: Public_name: rr48
    Other_name: T01C8.1c.1:c.436C>T
      T01C8.1b.1:c.622C>T
      CE31223:p.His208Tyr
      CE31222:p.His208Tyr
      T01C8.1a.1:c.622C>T
      CE07458:p.His146Tyr
    HGVSg: CHROMOSOME_X:g.16800360C>T
  Sequence_details: SMap: S_parent: Sequence: T01C8
    Flanking_sequences: gttgactactgtcatcgtcatatggttgtc atagagatttgaagccagagaatttgttgc
    Mapping_target: T01C8
    Type_of_mutation: Substitution: c t
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00026692
    Laboratory: MR
    Status: Live
  Affects: Gene: WBGene00020142
    Transcript: T01C8.1b.1 (12)
      T01C8.1c.1 (12)
      T01C8.1a.1 (12)
  Genetics: Interpolated_map_position: X 24.0615
  Description: Phenotype: WBPhenotype:0000462 Paper_evidence: WBPaper00031692
        Curator_confirmed: WBPerson2021
        Remark: aak-2 mutant worms showed hypersensitivity to paraquat Paper_evidence: WBPaper00031692
            Curator_confirmed: WBPerson2021
        Affected_by: Molecule: WBMol:00002747 Paper_evidence: WBPaper00031692
              Curator_confirmed: WBPerson2021
      WBPhenotype:0001171 Paper_evidence: WBPaper00041842
        Curator_confirmed: WBPerson2987
        Remark: Table 2, SIII Paper_evidence: WBPaper00041842
            Curator_confirmed: WBPerson2987
      WBPhenotype:0001871 Paper_evidence: WBPaper00035656
        Curator_confirmed: WBPerson2021
        Remark: Unlike wildtype, metformin treatment decreased mid-life viability in aak-2 mutants in a dose-dependent manner Paper_evidence: WBPaper00035656
            Curator_confirmed: WBPerson2021
      WBPhenotype:0001872 Paper_evidence: WBPaper00035656
        Curator_confirmed: WBPerson2021
        Remark: Unlike wildtype, metformin treatment reduced locomotory ability in aak-2 mutant strains Paper_evidence: WBPaper00035656
            Curator_confirmed: WBPerson2021
      WBPhenotype:0002276 Paper_evidence: WBPaper00032396
        Curator_confirmed: WBPerson2987
        Remark: aak-2(rr48);daf-2(e1370) double mutant animals exhibited a significantly reduced dauer life span compared to control daf-2(e1370) mutant animals (Table 1) Paper_evidence: WBPaper00032396
            Curator_confirmed: WBPerson2987
        Phenotype_assay: Treatment: C. elegans were synchronized and plated at 25 degrees Celsius. Three days later, ~10 dauer larvae were randomly picked into a 20 microliter drop of double-distilled water suspended under a Petri dish cover. A wet tissue was placed in the bottom of the dish to maintain humidity, and the plate was sealed with Parafilm. Dauer longevity was monitored daily, and survival was scored as moving response upon exposure to a focused beam of 425-440 nm light. Paper_evidence: WBPaper00032396
              Curator_confirmed: WBPerson2987
          Temperature: 25 Paper_evidence: WBPaper00032396
              Curator_confirmed: WBPerson2987
          Genotype: daf-2(e1370) Paper_evidence: WBPaper00032396
              Curator_confirmed: WBPerson2987
    Phenotype_not_observed: WBPhenotype:0000147 Paper_evidence: WBPaper00040181
        Curator_confirmed: WBPerson712
        Remark: Animals exhibited rapid depletion of lipid stores upon starvation like that observed in control animals. Starvation-enhanced rRNA biosynthesis and lpd-7 mRNA expression also increased in the starved male worms. Paper_evidence: WBPaper00040181
            Curator_confirmed: WBPerson712
        EQ_annotations: Life_stage: WBls:0000056 PATO:0000460 Paper_evidence: WBPaper00040181
                Curator_confirmed: WBPerson712
  Reference: WBPaper00040181
    WBPaper00041842
    WBPaper00035656
    WBPaper00031692
    WBPaper00032396
  Method: Substitution_allele