WormBase Tree Display for Variation: WBVar00241331
expand all nodes | collapse all nodes | view schema
| WBVar00241331 | Evidence | Paper_evidence | WBPaper00005804 | ||||
|---|---|---|---|---|---|---|---|
| Name (3) | |||||||
| Sequence_details | SMap | S_parent | Sequence | C47E8 | |||
| Flanking_sequences | acacaattggagttcacaccaatgcataaa | aagcaagaattcagttaccagatatgcaaa | |||||
| Mapping_target | C47E8 | ||||||
| Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00005804 | ||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin (3) | |||||||
| Linked_to | WBVar00241329 | ||||||
| WBVar00601267 | |||||||
| Affects | Gene | WBGene00006836 | |||||
| Transcript | C47E8.7.1 (12) | ||||||
| Genetics | Interpolated_map_position | V | 6.70021 | ||||
| Reference | WBPaper00005804 | ||||||
| Remark | ra202 is a revertant of r367. The allele alteration is same as the revertants ra233 and ra236 | Paper_evidence | WBPaper00005804 | ||||
| Cis double mutant | |||||||
| Method | Substitution_allele |
