WormBase Tree Display for Variation: WBVar00240193
expand all nodes | collapse all nodes | view schema
| WBVar00240193 | Evidence | Paper_evidence | WBPaper00002627 | ||
|---|---|---|---|---|---|
| Name | Public_name | WBVar00240193 | |||
| Other_name | pkP602 | ||||
| Sequence_details | SMap | S_parent | Sequence | W02C12 | |
| Flanking_sequences | gaaaaattcaaaattctaaaatttaaatat | atgtgttccggttcagcccgcaaaaagtgt | |||
| Mapping_target | W02C12 | ||||
| Type_of_mutation | Insertion | ||||
| SeqStatus | Sequenced | ||||
| Variation_type | Transposon_insertion | Tc1 | |||
| Natural_variant | |||||
| Origin | Species | Caenorhabditis elegans | |||
| Strain | WBStrain00033541 | ||||
| Laboratory | NL | ||||
| Status | Live | ||||
| Affects | Gene | WBGene00018547 | |||
| WBGene00020929 | |||||
| Transcript | F47C12.2.1 | ||||
| W02C12.2b.1 | |||||
| W02C12.2a.1 | |||||
| Genetics | Interpolated_map_position | IV | -1.05113 | ||
| Reference | WBPaper00002627 | ||||
| Remark | This insertion site was identified using sequence from a shotgun library of Tc1 flanks. It should be confirmed before it is studied further | Paper_evidence | WBPaper00002627 | ||
| Method | Transposon_insertion |
