WormBase Tree Display for Variation: WBVar00239339
expand all nodes | collapse all nodes | view schema
| WBVar00239339 | Evidence | Paper_evidence | WBPaper00005275 | ||||
|---|---|---|---|---|---|---|---|
| Name | Public_name | pk862 | |||||
| Other_name | F17C8.1.1:c.-39C>T | ||||||
| HGVSg | CHROMOSOME_III:g.4722173C>T | ||||||
| Sequence_details | SMap | S_parent | Sequence | F17C8 | |||
| Flanking_sequences | tgcctcatcttcttccttttcatttttcaa | gtcttctattctgaagattcttcttgtctt | |||||
| Mapping_target | F17C8 | ||||||
| Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00005275 | ||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Laboratory | NL | ||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00000068 | |||||
| Transcript | F17C8.1.1 | VEP_consequence | 5_prime_UTR_variant | ||||
| VEP_impact | MODIFIER | ||||||
| HGVSc | F17C8.1.1:c.-39C>T | ||||||
| cDNA_position | 79 | ||||||
| Exon_number | 1/15 | ||||||
| Genetics | Interpolated_map_position | III | -2.71895 | ||||
| Reference | WBPaper00005275 | ||||||
| Remark | Mutation lies 39bp upstream of ATG | Paper_evidence | WBPaper00005275 | ||||
| Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00000068 Genomic_neighbourhood | Paper_evidence | WBPaper00005275 | |||||
| Method | Substitution_allele |
