WormBase Tree Display for Variation: WBVar00239329
expand all nodes | collapse all nodes | view schema
| WBVar00239329 | Evidence | Paper_evidence | WBPaper00006028 | ||||
|---|---|---|---|---|---|---|---|
| Name | Public_name | pk710 | |||||
| Other_name | CE40346:p.Trp193Ter | ||||||
| B0379.3a.1:c.578G>A | |||||||
| B0379.3b.1:c.566G>A | |||||||
| CE40347:p.Trp189Ter | |||||||
| HGVSg | CHROMOSOME_I:g.10080870G>A | ||||||
| Sequence_details | SMap | S_parent | Sequence | B0379 | |||
| Flanking_sequences | aacacgcccatgcacttgtacgaggaggtt | gctgcagtccaaagagggcgcattctttcc | |||||
| Mapping_target | B0379 | ||||||
| Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00006028 | ||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Strain | WBStrain00028974 | ||||||
| Laboratory | NL | ||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00003508 | |||||
| Transcript | B0379.3a.1 | VEP_consequence | stop_gained | ||||
| VEP_impact | HIGH | ||||||
| HGVSc | B0379.3a.1:c.578G>A | ||||||
| HGVSp | CE40346:p.Trp193Ter | ||||||
| cDNA_position | 581 | ||||||
| CDS_position | 578 | ||||||
| Protein_position | 193 | ||||||
| Exon_number | 5/16 | ||||||
| Codon_change | tGg/tAg | ||||||
| Amino_acid_change | W/* | ||||||
| B0379.3b.1 | VEP_consequence | stop_gained | |||||
| VEP_impact | HIGH | ||||||
| HGVSc | B0379.3b.1:c.566G>A | ||||||
| HGVSp | CE40347:p.Trp189Ter | ||||||
| cDNA_position | 569 | ||||||
| CDS_position | 566 | ||||||
| Protein_position | 189 | ||||||
| Exon_number | 5/16 | ||||||
| Codon_change | tGg/tAg | ||||||
| Amino_acid_change | W/* | ||||||
| Genetics | Interpolated_map_position | I | 4.60688 | ||||
| Description | Phenotype | WBPhenotype:0000059 | Paper_evidence | WBPaper00059651 | |||
| Curator_confirmed | WBPerson712 | ||||||
| Remark | One thousand L1 stage animals of each strain were plated at 20C. After seventy-two hours, the developmental stage of the individuals was assessed. We found that 28% of both mut-16 and mut-16(pk710) mutant individuals arrested as larvae compared to 0% of wild-type individuals (Figure 1). | Paper_evidence | WBPaper00059651 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| WBPhenotype:0001208 | Paper_evidence | WBPaper00041208 | |||||
| Curator_confirmed | WBPerson2733 | ||||||
| Reference | WBPaper00041208 | ||||||
| WBPaper00006028 | |||||||
| WBPaper00059651 | |||||||
| WBPaper00065001 | |||||||
| Method | Substitution_allele |
