WormBase Tree Display for Variation: WBVar00239284
expand all nodes | collapse all nodes | view schema
WBVar00239284 | Evidence | Paper_evidence | WBPaper00031936 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | pk349 | |||||||
Other_name | pk349df | ||||||||
CE20515:p.Ile67Ter | |||||||||
C16A11.1b.1:c.697_1492del | |||||||||
C16A11.1a.1:c.199_994del | |||||||||
C16A11.1a.2:c.199_994del | |||||||||
CE45827:p.Ile233Ter | |||||||||
HGVSg | CHROMOSOME_II:g.4253250_4255183del | ||||||||
Sequence_details | SMap | S_parent | Sequence | C16A11 | |||||
Flanking_sequences | gatttggattacgtgaattttcgatattta | taaccaatgcgacagacactcggaatattg | |||||||
Mapping_target | C16A11 | ||||||||
Type_of_mutation (2) | |||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin (4) | |||||||||
Affects | Gene | WBGene00001673 | |||||||
Transcript | C16A11.1a.1 (11) | ||||||||
C16A11.1b.1 (11) | |||||||||
C16A11.1a.2 (11) | |||||||||
Isolation | Mutagen | EMS | |||||||
Genetics | Interpolated_map_position | II | -5.00625 | ||||||
Mapping_data | In_multi_point | 4377 | |||||||
Description | Phenotype (18) | ||||||||
Phenotype_not_observed | WBPhenotype:0001048 | Paper_evidence | WBPaper00003465 | ||||||
Curator_confirmed | WBPerson291 | ||||||||
WBPhenotype:0001414 | Paper_evidence | WBPaper00003465 | |||||||
Curator_confirmed | WBPerson291 | ||||||||
WBPhenotype:0001434 | Paper_evidence | WBPaper00003465 | |||||||
Curator_confirmed | WBPerson291 | ||||||||
WBPhenotype:0001765 | Paper_evidence | WBPaper00031936 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Animals with mutations in individual G protein subunits respond normally to CO2 | Paper_evidence | WBPaper00031936 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00031936 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | 10% CO2 | Paper_evidence | WBPaper00031936 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0002535 | Paper_evidence | WBPaper00003465 | |||||||
Curator_confirmed | WBPerson291 | ||||||||
Reference | WBPaper00043908 | ||||||||
WBPaper00031936 | |||||||||
WBPaper00003465 | |||||||||
Method | Deletion_and_insertion_allele |