WormBase Tree Display for Variation: WBVar00146368
expand all nodes | collapse all nodes | view schema
WBVar00146368 | Name | Public_name | gm324 | ||||||
---|---|---|---|---|---|---|---|---|---|
Other_name | C07G1.4a.1:c.203_538+798del | ||||||||
HGVSg | CHROMOSOME_IV:g.8196630_8198521del | ||||||||
Sequence_details | SMap | S_parent | Sequence | C07G1 | |||||
Flanking_sequences | aacttttaaaatcagatcgtggtgcatgga | agtaactttccatccgttctcctgtttgcc | |||||||
Mapping_target | C07G1 | ||||||||
Type_of_mutation | Deletion | ||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00028743 | ||||||||
Laboratory | NG | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00006957 | |||||||
Transcript | C07G1.4a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | C07G1.4a.1:c.203_538+798del | ||||||||
cDNA_position | 227-? | ||||||||
CDS_position | 203-? | ||||||||
Protein_position | 68-? | ||||||||
Intron_number | 3-4/11 | ||||||||
Exon_number | 3-4/12 | ||||||||
Interactor | WBInteraction000009180 | ||||||||
WBInteraction000009181 | |||||||||
WBInteraction000051765 | |||||||||
WBInteraction000051766 | |||||||||
Genetics | Interpolated_map_position | IV | 3.6599 | ||||||
Mapping_data | In_multi_point | 5010 | |||||||
Description | Phenotype | WBPhenotype:0000384 | Paper_evidence | WBPaper00032090 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals exhibited mild VD/DD axon guidance defects. However, only 2% PDE axons failed to reach the VCN or reached it at a >45 angle from the PDE cell body (n=100). | Paper_evidence | WBPaper00032090 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006747 | PATO:0000460 | Paper_evidence | WBPaper00032090 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0005270 | PATO:0000460 | Paper_evidence | WBPaper00032090 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0005303 | PATO:0000460 | Paper_evidence | WBPaper00032090 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Phenotypes were also scored for maternally rescued progeny. | Paper_evidence | WBPaper00032090 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Genotype | juIs73 or osm-6::gfp | Paper_evidence | WBPaper00032090 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000882 | Paper_evidence | WBPaper00056964 | |||||||
Curator_confirmed | WBPerson48777 | ||||||||
Remark | 3° dendrites that fail to self-avoid and overgrow one another. Fig 3D | Paper_evidence | WBPaper00056964 | ||||||
Curator_confirmed | WBPerson48777 | ||||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00056964 | ||||||
Curator_confirmed | WBPerson48777 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006831 | PATO:0000460 | Paper_evidence | WBPaper00056964 | ||||
Curator_confirmed | WBPerson48777 | ||||||||
Phenotype_assay | Control_strain | WBStrain00047813 | Paper_evidence | WBPaper00056964 | |||||
Curator_confirmed | WBPerson48777 | ||||||||
Genotype | wdIs52 (pF49H12.4::GFP) | Paper_evidence | WBPaper00056964 | ||||||
Curator_confirmed | WBPerson48777 | ||||||||
WBPhenotype:0002490 | Paper_evidence | WBPaper00032090 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | 3% ectopic axon branches emanated from axons that were not misguided (n=100) in progeny from homozygous parents, but was 0% in progeny from heterozygous hermaphrodites. | Paper_evidence | WBPaper00032090 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Low | Paper_evidence | WBPaper00032090 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006747 | PATO:0000460 | Paper_evidence | WBPaper00032090 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Maternal | |||||||||
Phenotype_assay | Treatment | Phenotypes were also scored for maternally rescued progeny. | Paper_evidence | WBPaper00032090 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0000062 | Paper_evidence | WBPaper00032090 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals are viable as homozygotes. | Paper_evidence | WBPaper00032090 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000180 | Paper_evidence | WBPaper00032090 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | 0% axons were prematurely terminated and thickened (n=100). | Paper_evidence | WBPaper00032090 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006747 | PATO:0000460 | Paper_evidence | WBPaper00032090 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Phenotypes were also scored for maternally rescued progeny. | Paper_evidence | WBPaper00032090 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000436 | Paper_evidence | WBPaper00040857 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Mutants showed normal localization of SNB-1::VENUS in the RIA neuron. | Paper_evidence | WBPaper00040857 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000905 | Paper_evidence | WBPaper00032090 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | 0% cell bodies and axons displayed a spread morphology or ectopic lamellipodia/filopodia-like structure (n=100). | Paper_evidence | WBPaper00032090 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006747 | PATO:0000460 | Paper_evidence | WBPaper00032090 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Phenotypes were also scored for maternally rescued progeny. | Paper_evidence | WBPaper00032090 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001930 | Paper_evidence | WBPaper00032907 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals display similar numbers of dorsal and ventral muscle arms compared to control animals. | Paper_evidence | WBPaper00032907 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00040857 | ||||||||
WBPaper00032090 | |||||||||
WBPaper00032907 | |||||||||
WBPaper00048842 | |||||||||
WBPaper00056964 | |||||||||
Remark | Allele erroneously cited as gm423 | Paper_evidence | WBPaper00048842 | ||||||
Method | Deletion_allele |