WormBase Tree Display for Variation: WBVar00145843
expand all nodes | collapse all nodes | view schema
WBVar00145843 | Name | Public_name | gk437 | |||||
---|---|---|---|---|---|---|---|---|
Sequence_details | SMap | S_parent | Sequence | Y41G9A | ||||
Flanking_sequences | taacaacaacaacaaaaactttttttacca | agtatttgttttttgtttggagtttttttt | ||||||
Mapping_target | Y41G9A | |||||||
Type_of_mutation | Insertion | ATTGTTTTTCAAA | ||||||
Deletion | ||||||||
PCR_product (2) | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain (17) | ||||||||
Laboratory | VC | |||||||
Person | WBPerson427 | |||||||
KO_consortium_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00003262 | ||||||
Transcript | Y41G9A.7 | |||||||
Interactor | WBInteraction000525383 | |||||||
WBInteraction000540778 | ||||||||
WBInteraction000540779 | ||||||||
WBInteraction000540780 | ||||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Mapping_data | In_multi_point | 5597 | |||||
Description | Phenotype | WBPhenotype:0000061 | Paper_evidence | WBPaper00040404 | ||||
Curator_confirmed | WBPerson557 | |||||||
Recessive | Paper_evidence | WBPaper00040404 | ||||||
Curator_confirmed | WBPerson557 | |||||||
Variation_effect | Loss_of_function_undetermined_extent | Paper_evidence | WBPaper00040404 | |||||
Curator_confirmed | WBPerson557 | |||||||
Phenotype_assay | Temperature | 20 | Paper_evidence | WBPaper00040404 | ||||
Curator_confirmed | WBPerson557 | |||||||
WBPhenotype:0000295 | Paper_evidence | WBPaper00040404 | ||||||
Curator_confirmed | WBPerson557 | |||||||
Remark | mir-34 mutants displayed a marked increase in resistance to heat at 35C. | Paper_evidence | WBPaper00040404 | |||||
Curator_confirmed | WBPerson557 | |||||||
Recessive | Paper_evidence | WBPaper00040404 | ||||||
Curator_confirmed | WBPerson557 | |||||||
Variation_effect | Loss_of_function_undetermined_extent | Paper_evidence | WBPaper00040404 | |||||
Curator_confirmed | WBPerson557 | |||||||
Phenotype_assay | Treatment | Synchronous worms at day 10 of adulthood were raised on NGM plates. Heat stress was applied by incubating worms on NGM plates at 35C. The surviving worms were scored every 5 h. | Paper_evidence | WBPaper00040404 | ||||
Curator_confirmed | WBPerson557 | |||||||
Temperature | 35 | Paper_evidence | WBPaper00040404 | |||||
Curator_confirmed | WBPerson557 | |||||||
WBPhenotype:0001273 | Paper_evidence | WBPaper00040404 | ||||||
Curator_confirmed | WBPerson557 | |||||||
Remark | mir-34 mutants displayed a marked increase in resistance to heat at 35C. | Paper_evidence | WBPaper00040404 | |||||
Curator_confirmed | WBPerson557 | |||||||
Recessive | Paper_evidence | WBPaper00040404 | ||||||
Curator_confirmed | WBPerson557 | |||||||
Variation_effect | Loss_of_function_undetermined_extent | Paper_evidence | WBPaper00040404 | |||||
Curator_confirmed | WBPerson557 | |||||||
Phenotype_assay | Treatment | Synchronous worms at day 10 of adulthood were raised on NGM plates. Heat stress was applied by incubating worms on NGM plates at 35C. The surviving worms were scored every 5 h. | Paper_evidence | WBPaper00040404 | ||||
Curator_confirmed | WBPerson557 | |||||||
Temperature | 35 | Paper_evidence | WBPaper00040404 | |||||
Curator_confirmed | WBPerson557 | |||||||
WBPhenotype:0001663 | Paper_evidence | WBPaper00040404 | ||||||
Curator_confirmed | WBPerson557 | |||||||
Remark | mir-34 mutants displayed a marked increase in resistance to oxidative stress induced by hydrogen peroxide. | Paper_evidence | WBPaper00040404 | |||||
Curator_confirmed | WBPerson557 | |||||||
Recessive | Paper_evidence | WBPaper00040404 | ||||||
Curator_confirmed | WBPerson557 | |||||||
Variation_effect | Loss_of_function_undetermined_extent | Paper_evidence | WBPaper00040404 | |||||
Curator_confirmed | WBPerson557 | |||||||
Phenotype_assay | Treatment | Synchronous worms at day 10 of adulthood were raised on NGM plates. Hydrogen peroxide was used to induce oxidative stress. Animals were exposed to 2.5 mM hydrogen peroxide on NGM plates at 20C, and survival was scored every hour. | Paper_evidence | WBPaper00040404 | ||||
Curator_confirmed | WBPerson557 | |||||||
Temperature | 20 | Paper_evidence | WBPaper00040404 | |||||
Curator_confirmed | WBPerson557 | |||||||
Reference | WBPaper00040404 | |||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||||
Method | KO_consortium_allele |