WormBase Tree Display for Variation: WBVar00145505
expand all nodes | collapse all nodes | view schema
WBVar00145505 | Evidence | Paper_evidence | WBPaper00040652 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | gk54 | ||||||
Other_name | C18A11.7b.1:c.153_213+72del | |||||||
C18A11.7a.1:c.1101_1161+72del | ||||||||
HGVSg | CHROMOSOME_X:g.8052295_8052427del | |||||||
Sequence_details | SMap | S_parent | Sequence | C18A11 | ||||
Flanking_sequences | agatttgagcagatggcattttggatgagg | cgtccagagttttcgacctccttctgtaaa | ||||||
Mapping_target | C18A11 | |||||||
Type_of_mutation | Deletion | |||||||
PCR_product | GK54_external | |||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00035507 | |||||||
Laboratory | VC | |||||||
Person | WBPerson427 | |||||||
KO_consortium_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00001000 | ||||||
Transcript | C18A11.7a.1 | VEP_consequence | splice_donor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | C18A11.7a.1:c.1101_1161+72del | |||||||
cDNA_position | 1109-? | |||||||
CDS_position | 1101-? | |||||||
Protein_position | 367-? | |||||||
Intron_number | 9/13 | |||||||
Exon_number | 9/14 | |||||||
C18A11.7b.1 | VEP_consequence | splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | C18A11.7b.1:c.153_213+72del | |||||||
cDNA_position | 155-? | |||||||
CDS_position | 153-? | |||||||
Protein_position | 51-? | |||||||
Intron_number | 3/7 | |||||||
Exon_number | 3/8 | |||||||
Interactor | WBInteraction000501326 | |||||||
Isolation | Mutagen | UV/TMP | ||||||
Description | Phenotype | WBPhenotype:0001889 | Paper_evidence | WBPaper00040652 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Attachment complexes are disorganised (e.g. not nicely arrayed Z and M lines) in dim-1 mutants. | Paper_evidence | WBPaper00040652 | |||||
Curator_confirmed | WBPerson712 | |||||||
Recessive | Paper_evidence | WBPaper00040652 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Temperature_sensitive | Heat_sensitive | 25 | Paper_evidence | WBPaper00040652 | ||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00040652 | |||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||||
Method | KO_consortium_allele |