WormBase Tree Display for Variation: WBVar00145183
expand all nodes | collapse all nodes | view schema
| WBVar00145183 | Evidence | Paper_evidence | WBPaper00005374 | ||||||
|---|---|---|---|---|---|---|---|---|---|
| Name | Public_name | ep169 | |||||||
| Other_name | VF36H2L.1.1:c.573G>A | ||||||||
| CE16526:p.Trp191Ter | |||||||||
| HGVSg | CHROMOSOME_I:g.9232679C>T | ||||||||
| Sequence_details | SMap | S_parent | Sequence | VF36H2L | |||||
| Flanking_sequences | atttcatgttacatggactattatggtttg | gactcgtgccataaaattggaaggatacct | |||||||
| Mapping_target | VF36H2L | ||||||||
| Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00005374 | ||||
| SeqStatus | Sequenced | ||||||||
| Variation_type | Allele | ||||||||
| Origin | Species | Caenorhabditis elegans | |||||||
| Laboratory | CE | ||||||||
| Status | Live | ||||||||
| Affects | Gene | WBGene00000147 | |||||||
| Transcript | VF36H2L.1.1 | VEP_consequence | stop_gained | ||||||
| VEP_impact | HIGH | ||||||||
| HGVSc | VF36H2L.1.1:c.573G>A | ||||||||
| HGVSp | CE16526:p.Trp191Ter | ||||||||
| cDNA_position | 576 | ||||||||
| CDS_position | 573 | ||||||||
| Protein_position | 191 | ||||||||
| Exon_number | 4/6 | ||||||||
| Codon_change | tgG/tgA | ||||||||
| Amino_acid_change | W/* | ||||||||
| Genetics | Interpolated_map_position | I | 3.67908 | ||||||
| Description | Phenotype | WBPhenotype:0000006 | Paper_evidence | WBPaper00005374 | |||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Remark | Homozygous mutants are Egl | Paper_evidence | WBPaper00005374 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Variation_effect | Null | Paper_evidence | WBPaper00005374 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00005374 | ||||
| Curator_confirmed | WBPerson2021 | ||||||||
| WBPhenotype:0000052 | Paper_evidence | WBPaper00005374 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Remark | Homozygous mutants are Mel | Paper_evidence | WBPaper00005374 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Variation_effect | Null | Paper_evidence | WBPaper00005374 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00005374 | ||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Maternal | |||||||||
| WBPhenotype:0000080 | Paper_evidence | WBPaper00005374 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Remark | Mutants fail to make anterior pharynx (Aph phenotype) | Paper_evidence | WBPaper00005374 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Variation_effect | Null | Paper_evidence | WBPaper00005374 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00005374 | ||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Maternal | |||||||||
| WBPhenotype:0001566 | Paper_evidence | WBPaper00005374 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Remark | Hypodermal cells fail to enclose the embryo ventrally | Paper_evidence | WBPaper00005374 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Variation_effect | Null | Paper_evidence | WBPaper00005374 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00005374 | ||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Maternal | |||||||||
| Reference | WBPaper00005374 | ||||||||
| Method | Substitution_allele |
