WormBase Tree Display for Variation: WBVar00145018
expand all nodes | collapse all nodes | view schema
| WBVar00145018 | Evidence | Paper_evidence | WBPaper00028462 | |||
|---|---|---|---|---|---|---|
| Name | Public_name | e2821 | ||||
| Sequence_details | SMap | S_parent | Sequence | CHROMOSOME_X | ||
| Flanking_sequences | GAATTGGGCTCAAGAAAATGGTGGGAGTTTCGCTGGCTGGAAATATATAT | GGCCGCAAAGGTTATGTAACTAGTATGTAATTCTAACCGACAAGGCACCT | ||||
| Mapping_target | CHROMOSOME_X | |||||
| Type_of_mutation | Insertion | t | Paper_evidence | WBPaper00028462 | ||
| Deletion | ||||||
| SeqStatus | Sequenced | |||||
| Variation_type | Allele | |||||
| Origin | Species | Caenorhabditis elegans | ||||
| Laboratory | CB | |||||
| Status | Live | Curator_confirmed | WBPerson4025 | |||
| Affects | Gene (20) | |||||
| Transcript (26) | ||||||
| Genetics | Interpolated_map_position | X | 1.75927 | |||
| Reference | WBPaper00028462 | |||||
| Remark | This was suppressed because it overlapped with a corrected genome sequence error feature | Feature_evidence | WBsf898329 | |||
| This was un-suppressed after examination showed it is not changed by the corrected genome sequence error | Curator_confirmed | WBPerson4025 | ||||
| Method | Deletion_and_insertion_allele |
