WormBase Tree Display for Variation: WBVar00144937
expand all nodes | collapse all nodes | view schema
WBVar00144937 | Evidence | Paper_evidence | WBPaper00026735 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | e2706 | ||||||
Other_name | CE28024:p.Gly1349Ile | |||||||
F39B2.4a.1:c.4039_4040delinsAT | ||||||||
F39B2.4b.1:c.4045_4046delinsAT | ||||||||
CE28023:p.Gly1347Ile | ||||||||
HGVSg | CHROMOSOME_I:g.14779080_14779081delinsAT | |||||||
Sequence_details | SMap | S_parent | Sequence | F39B2 | ||||
Flanking_sequences | ttgttctacaattgcaaatatttcttcgcc | agactttttgaggaatacggcgatcactga | ||||||
Mapping_target | F39B2 | |||||||
Type_of_mutation | Substitution | gg | at | Paper_evidence | WBPaper00023901 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | CB | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00006349 | ||||||
Transcript | F39B2.4b.1 | VEP_consequence | missense_variant | |||||
VEP_impact | MODERATE | |||||||
HGVSc | F39B2.4b.1:c.4045_4046delinsAT | |||||||
HGVSp | CE28024:p.Gly1349Ile | |||||||
cDNA_position | 4052-4053 | |||||||
CDS_position | 4045-4046 | |||||||
Protein_position | 1349 | |||||||
Exon_number | 16/19 | |||||||
Codon_change | GGa/ATa | |||||||
Amino_acid_change | G/I | |||||||
F39B2.4a.1 | VEP_consequence | missense_variant | ||||||
VEP_impact | MODERATE | |||||||
HGVSc | F39B2.4a.1:c.4039_4040delinsAT | |||||||
HGVSp | CE28023:p.Gly1347Ile | |||||||
cDNA_position | 4047-4048 | |||||||
CDS_position | 4039-4040 | |||||||
Protein_position | 1347 | |||||||
Exon_number | 16/19 | |||||||
Codon_change | GGa/ATa | |||||||
Amino_acid_change | G/I | |||||||
Genetics | Interpolated_map_position | I | 26.8156 | |||||
Description | Phenotype (5) | |||||||
Phenotype_not_observed | WBPhenotype:0001212 | Paper_evidence | WBPaper00026735 | |||||
Curator_confirmed | WBPerson48 | |||||||
Remark | Based on a comparison of bleach sensitivity with wild type worms. | Paper_evidence | WBPaper00026735 | |||||
Curator_confirmed | WBPerson48 | |||||||
WBPhenotype:0001411 | Paper_evidence | WBPaper00026735 | ||||||
Curator_confirmed | WBPerson48 | |||||||
Remark | Based on lectin binding properties to the cuticle | Paper_evidence | WBPaper00026735 | |||||
Curator_confirmed | WBPerson48 | |||||||
Phenotype_assay | Treatment | Tested the following fluorescein or rhodamine-conjugated lectins: WGA, SBA, TPA, PEA,, CON, LEA. | Paper_evidence | WBPaper00026735 | ||||
Curator_confirmed | WBPerson48 | |||||||
WBPhenotype:0001415 | Paper_evidence | WBPaper00026735 | ||||||
Curator_confirmed | WBPerson48 | |||||||
WBPhenotype:0001420 | Paper_evidence | WBPaper00029153 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | No difference was observed between mutant and wild-type in terms of the amount of biofilm accumulated on the nose of the worm. | Paper_evidence | WBPaper00029153 | |||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00026735 | |||||||
WBPaper00024311 | ||||||||
WBPaper00029153 | ||||||||
Method | Substitution_allele |