WormBase Tree Display for Variation: WBVar00144937
expand all nodes | collapse all nodes | view schema
WBVar00144937 | Evidence | Paper_evidence | WBPaper00026735 | |||||
---|---|---|---|---|---|---|---|---|
Name (3) | ||||||||
Sequence_details | SMap | S_parent | Sequence | F39B2 | ||||
Flanking_sequences | ttgttctacaattgcaaatatttcttcgcc | agactttttgaggaatacggcgatcactga | ||||||
Mapping_target | F39B2 | |||||||
Type_of_mutation | Substitution | gg | at | Paper_evidence | WBPaper00023901 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | CB | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00006349 | ||||||
Transcript | F39B2.4b.1 | VEP_consequence | missense_variant | |||||
VEP_impact | MODERATE | |||||||
HGVSc | F39B2.4b.1:c.4045_4046delinsAT | |||||||
HGVSp | CE28024:p.Gly1349Ile | |||||||
cDNA_position | 4052-4053 | |||||||
CDS_position | 4045-4046 | |||||||
Protein_position | 1349 | |||||||
Exon_number | 16/19 | |||||||
Codon_change | GGa/ATa | |||||||
Amino_acid_change | G/I | |||||||
F39B2.4a.1 | VEP_consequence | missense_variant | ||||||
VEP_impact | MODERATE | |||||||
HGVSc | F39B2.4a.1:c.4039_4040delinsAT | |||||||
HGVSp | CE28023:p.Gly1347Ile | |||||||
cDNA_position | 4047-4048 | |||||||
CDS_position | 4039-4040 | |||||||
Protein_position | 1347 | |||||||
Exon_number | 16/19 | |||||||
Codon_change | GGa/ATa | |||||||
Amino_acid_change | G/I | |||||||
Genetics | Interpolated_map_position | I | 26.8156 | |||||
Description | Phenotype | WBPhenotype:0000006 | Paper_evidence | WBPaper00026735 | ||||
Curator_confirmed | WBPerson48 | |||||||
Temperature_sensitive | Cold_sensitive | Paper_evidence | WBPaper00026735 | |||||
Curator_confirmed | WBPerson48 | |||||||
WBPhenotype:0000218 | Paper_evidence | WBPaper00026735 | ||||||
Curator_confirmed | WBPerson48 | |||||||
Temperature_sensitive | Cold_sensitive | Paper_evidence | WBPaper00026735 | |||||
Curator_confirmed | WBPerson48 | |||||||
WBPhenotype:0000651 | Paper_evidence | WBPaper00024311 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals become severely constipated compared to wild-type worms, although not to the same extent as ERK MAP kinase cascade mutants, when grown on lawns of M. nematophilum, whereas they are not constipated when grown on standard E. coli food source, OP50. | Paper_evidence | WBPaper00024311 | |||||
Curator_confirmed | WBPerson712 | |||||||
Penetrance | Incomplete | 34% of the animals exhibit severe constipation. | Paper_evidence | WBPaper00024311 | ||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Treatment | Animals were grown on NGM plates seeded with trace (usually 0.01% (v/v)) M. nematophilum in OP50. Strains were cultured on these plates at 25*C. | Paper_evidence | WBPaper00024311 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000700 | Paper_evidence | WBPaper00024311 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | 11% (n=122) of animals display hyperinduction of vulval hypodermal cells. | Paper_evidence | WBPaper00024311 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Temperature | 15C | Paper_evidence | WBPaper00024311 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001413 | Paper_evidence (2) | |||||||
Curator_confirmed | WBPerson48 | |||||||
WBPerson712 | ||||||||
Remark | Exhibits poor growth, compared to wild type when grown with M. nematophilum. | Paper_evidence | WBPaper00026735 | |||||
Curator_confirmed | WBPerson48 | |||||||
Animals failed to swell when exposed to Microbacterium nematophilum, although bacteria were present in the rectum of these animals. Bacteria were visualized by nucleic acid dye SYTO 13. | Paper_evidence | WBPaper00024311 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Maternal | ||||||||
Phenotype_assay | Treatment | Animals were grown on NGM plates seeded with trace (usually 0.01% (v/v)) M. nematophilum in OP50. Strains were cultured on these plates at 25*C. | Paper_evidence | WBPaper00024311 | ||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_not_observed | WBPhenotype:0001212 | Paper_evidence | WBPaper00026735 | |||||
Curator_confirmed | WBPerson48 | |||||||
Remark | Based on a comparison of bleach sensitivity with wild type worms. | Paper_evidence | WBPaper00026735 | |||||
Curator_confirmed | WBPerson48 | |||||||
WBPhenotype:0001411 | Paper_evidence | WBPaper00026735 | ||||||
Curator_confirmed | WBPerson48 | |||||||
Remark | Based on lectin binding properties to the cuticle | Paper_evidence | WBPaper00026735 | |||||
Curator_confirmed | WBPerson48 | |||||||
Phenotype_assay | Treatment | Tested the following fluorescein or rhodamine-conjugated lectins: WGA, SBA, TPA, PEA,, CON, LEA. | Paper_evidence | WBPaper00026735 | ||||
Curator_confirmed | WBPerson48 | |||||||
WBPhenotype:0001415 | Paper_evidence | WBPaper00026735 | ||||||
Curator_confirmed | WBPerson48 | |||||||
WBPhenotype:0001420 | Paper_evidence | WBPaper00029153 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | No difference was observed between mutant and wild-type in terms of the amount of biofilm accumulated on the nose of the worm. | Paper_evidence | WBPaper00029153 | |||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00026735 | |||||||
WBPaper00024311 | ||||||||
WBPaper00029153 | ||||||||
Method | Substitution_allele |