WormBase Tree Display for Variation: WBVar00144860
expand all nodes | collapse all nodes | view schema
WBVar00144860 | Evidence | Paper_evidence | WBPaper00005085 | ||||
---|---|---|---|---|---|---|---|
Name (3) | |||||||
Sequence_details | SMap | S_parent | Sequence | R06F6 | |||
Flanking_sequences | gatcgcatcaagggacaacatccacgaacc | caaataagcttataaacttcagtcgccgca | |||||
Mapping_target | R06F6 | ||||||
Type_of_mutation | Substitution | c | t | ||||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain | WBStrain00022736 | ||||||
Laboratory | CB | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00000411 | |||||
Transcript | R06F6.1.1 | VEP_consequence | missense_variant | ||||
VEP_impact | MODERATE | ||||||
HGVSc | R06F6.1.1:c.790C>T | ||||||
HGVSp | CE51537:p.Pro264Ser | ||||||
cDNA_position | 807 | ||||||
CDS_position | 790 | ||||||
Protein_position | 264 | ||||||
Exon_number | 5/7 | ||||||
Codon_change | Cca/Tca | ||||||
Amino_acid_change | P/S | ||||||
Interactor | WBInteraction000001553 | ||||||
WBInteraction000001554 | |||||||
WBInteraction000001555 | |||||||
WBInteraction000001556 | |||||||
WBInteraction000001557 | |||||||
WBInteraction000521672 | |||||||
WBInteraction000521673 | |||||||
WBInteraction000521674 | |||||||
Genetics | Interpolated_map_position | II | 3.12582 | ||||
Description | Phenotype | WBPhenotype:0000050 | Paper_evidence | WBPaper00005085 | |||
Curator_confirmed | WBPerson712 | ||||||
Remark | Identified in a screen for zygotic embryonic lethal mutants. | Paper_evidence | WBPaper00005085 | ||||
Curator_confirmed | WBPerson712 | ||||||
Recessive | Paper_evidence | WBPaper00005085 | |||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0000241 | Paper_evidence | WBPaper00005085 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | While the majority of cell corpses in wild-type embryos disappeared within ~20 minutes, most corpses persisted much longer in cdl-1(e2510) embryos, as long as several hours. Excess cell corpses accumulate at the terminal arrest stage. Terminal embryos contained more than 8 cell corpses, compared to zero in wild-type embryos at the time of hatching. This allele is a neomorph that possesses a function detrimental to embryogenesis only when two copies are present: Df/e2510 embryos showed similar defects in cell death to those of the w37 embryos. | Paper_evidence | WBPaper00005085 | ||||
Curator_confirmed | WBPerson712 | ||||||
Recessive | Paper_evidence | WBPaper00005085 | |||||
Curator_confirmed | WBPerson712 | ||||||
Variation_effect | Neomorph_gain_of_function | Paper_evidence | WBPaper00005085 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0000242 | Paper_evidence | WBPaper00005085 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | Mutants exhibit defects in body elongation. Most e2510 embryos arrested between 1-fold and 1.5-fold. This allele is a neomorph that possesses a function detrimental to embryogenesis only when two copies are present: Df/e2510 embryos showed similar defects in elongation to those of the w37 embryos. | Paper_evidence | WBPaper00005085 | ||||
Curator_confirmed | WBPerson712 | ||||||
Recessive | Paper_evidence | WBPaper00005085 | |||||
Curator_confirmed | WBPerson712 | ||||||
Variation_effect | Neomorph_gain_of_function | Paper_evidence | WBPaper00005085 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0000243 | Paper_evidence | WBPaper00005085 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | While the majority of cell corpses in wild-type embryos disappeared within ~20 minutes, most corpses persisted much longer in cdl-1(e2510) embryos, as long as several hours. | Paper_evidence | WBPaper00005085 | ||||
Curator_confirmed | WBPerson712 | ||||||
Recessive | Paper_evidence | WBPaper00005085 | |||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0001748 | Paper_evidence | WBPaper00005085 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | Mutants exhibit defects in pharyngeal development. The pharyngeal basement membrane was almost always visible, but the pharynx was never connected with the buccal opening. | Paper_evidence | WBPaper00005085 | ||||
Curator_confirmed | WBPerson712 | ||||||
Recessive | Paper_evidence | WBPaper00005085 | |||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0002202 | Paper_evidence | WBPaper00005085 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | The pharynx primordium did not move anteriorly throughout embryogenesis in cdl-1 embryos. This defect in pharynx extension was seen in cdl- 1 embryos that elongated to over 3-fold as well as ones arrested at the 1- to 1.5-fold stage. | Paper_evidence | WBPaper00005085 | ||||
Curator_confirmed | WBPerson712 | ||||||
Recessive | Paper_evidence | WBPaper00005085 | |||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0010003 | Paper_evidence | WBPaper00005085 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | Most cell corpses in cdl-1(e2510) embryos appeared much later than those in the wild type: only ~10 corpses were observed in e2510 embryos between 220 and 470 minutes after first cleavage, during which wild-type embryos generated most cell corpses. | Paper_evidence | WBPaper00005085 | ||||
Curator_confirmed | WBPerson712 | ||||||
Recessive | Paper_evidence | WBPaper00005085 | |||||
Curator_confirmed | WBPerson712 | ||||||
Phenotype_not_observed | WBPhenotype:0001185 | Paper_evidence | WBPaper00005085 | ||||
Curator_confirmed | WBPerson712 | ||||||
Remark | The rate of cell division was not significantly affected in cdl-1(e2510) embryos, at least in some lineage of the AB decendant (data not shown). | Paper_evidence | WBPaper00005085 | ||||
Curator_confirmed | WBPerson712 | ||||||
Recessive | Paper_evidence | WBPaper00005085 | |||||
Curator_confirmed | WBPerson712 | ||||||
Reference | WBPaper00005085 | ||||||
Method | Substitution_allele |