WormBase Tree Display for Variation: WBVar00144555
expand all nodes | collapse all nodes | view schema
WBVar00144555 | Name | Public_name | e2091 | ||||||
---|---|---|---|---|---|---|---|---|---|
Other_name (5) | |||||||||
HGVSg | CHROMOSOME_III:g.4806599T>C | ||||||||
Sequence_details | SMap | S_parent | Sequence | C38D4 | |||||
Flanking_sequences | catacaccgcatcacctttaccgcctttca | ctctgtgccaaatcaagaaaacttgatatt | |||||||
Mapping_target | C38D4 | ||||||||
Type_of_mutation | Substitution | t | c | Paper_evidence | WBPaper00004312 | ||||
Curator_confirmed | WBPerson51134 | ||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin (4) | |||||||||
Affects | Gene | WBGene00003912 | |||||||
Transcript | C38D4.6b.1 | VEP_consequence | intron_variant | ||||||
VEP_impact | MODIFIER | ||||||||
HGVSc | C38D4.6b.1:c.764+101A>G | ||||||||
Intron_number | 7/8 | ||||||||
C38D4.6a.1 | VEP_consequence | intron_variant | |||||||
VEP_impact | MODIFIER | ||||||||
HGVSc | C38D4.6a.1:c.770+101A>G | ||||||||
Intron_number | 6/7 | ||||||||
C38D4.6b.2 | VEP_consequence | intron_variant | |||||||
VEP_impact | MODIFIER | ||||||||
HGVSc | C38D4.6b.2:c.764+101A>G | ||||||||
Intron_number | 6/7 | ||||||||
C38D4.6c.1 | VEP_consequence | intron_variant | |||||||
VEP_impact | MODIFIER | ||||||||
HGVSc | C38D4.6c.1:c.626+101A>G | ||||||||
Intron_number | 4/5 | ||||||||
C38D4.6a.2 | VEP_consequence | intron_variant | |||||||
VEP_impact | MODIFIER | ||||||||
HGVSc | C38D4.6a.2:c.770+101A>G | ||||||||
Intron_number | 7/8 | ||||||||
Interactor (12) | |||||||||
Genetics | Interpolated_map_position | III | -2.4658 | ||||||
Mapping_data | In_2_point | 4229 | |||||||
6036 | |||||||||
In_multi_point | 1482 | ||||||||
1483 | |||||||||
2081 | |||||||||
2083 | |||||||||
2085 | |||||||||
2086 | |||||||||
Description | Phenotype | WBPhenotype:0000050 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | some embryonic lethality | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000414 | Paper_evidence | WBPaper00004312 | |||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPerson2987 | |||||||||
Remark | V6 lineage transformed into V1-V4; cell autonomous action; variable additional defects | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
In pal-1(e2091) mutants the V6 cell adopts a fate similar to anterior seam cells V1-V4 in wild type, producing alae instead of rays. | Paper_evidence | WBPaper00004312 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006914 | PATO:0000460 | Paper_evidence | WBPaper00004312 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0007832 | PATO:0000460 | Paper_evidence | WBPaper00004312 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0004875 | PATO:0000460 | Paper_evidence | WBPaper00004312 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0004874 | PATO:0000460 | Paper_evidence | WBPaper00004312 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000425 | Paper_evidence | WBPaper00003428 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | pal-1(e2091) results in loss of PAL-1 expression, as determined by antibody staining, in the cells P9/10, V6, and C(a/p)aapp (Figure 4B, Table 1) | Paper_evidence | WBPaper00003428 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004412 | PATO:0000460 | Paper_evidence | WBPaper00003428 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0004411 | PATO:0000460 | Paper_evidence | WBPaper00003428 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0004875 | PATO:0000460 | Paper_evidence | WBPaper00003428 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0004874 | PATO:0000460 | Paper_evidence | WBPaper00003428 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0006521 | PATO:0000460 | Paper_evidence | WBPaper00003428 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0006399 | PATO:0000460 | Paper_evidence | WBPaper00003428 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000495 | Paper_evidence | WBPaper00004312 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | In pal-1(e2091) mutants, male tail ray 1 usually fails to migrate posteriorly into the fan region and forms a papilla on the side of the body. | Paper_evidence | WBPaper00004312 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006942 | PATO:0000460 | Paper_evidence | WBPaper00004312 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000961 | Paper_evidence | WBPaper00004312 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Expression of the MAB-5::LACZ transgene was lost in the V6 cell in embryos (Figure 3) | Paper_evidence | WBPaper00004312 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004875 | PATO:0000460 | Paper_evidence | WBPaper00004312 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0004874 | PATO:0000460 | Paper_evidence | WBPaper00004312 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00004312 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | MAB-5::LACZ | Paper_evidence | WBPaper00004312 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001278 | Paper_evidence | WBPaper00003428 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | pal-1(e2091) results in a loss of mab-5::lacZ expression in the V6 cells and in C(a/p)aapp cells (Figure 4B, Table 1) | Paper_evidence | WBPaper00003428 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004875 | PATO:0000460 | Paper_evidence | WBPaper00003428 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0004874 | PATO:0000460 | Paper_evidence | WBPaper00003428 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0006521 | PATO:0000460 | Paper_evidence | WBPaper00003428 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0006399 | PATO:0000460 | Paper_evidence | WBPaper00003428 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | muIs14 [mab-5::lacZ] | Paper_evidence | WBPaper00003428 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001509 | Paper_evidence | WBPaper00004312 | |||||||
WBPaper00004616 | |||||||||
WBPaper00004853 | |||||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPerson2987 | |||||||||
Remark | Adult males lack V6-derived rays. | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Absence of pal-1 in V6 results in failure to generate the V6 rays (rays 2-6) in the adult male in 96% of animals observed (Figure 1C). | Paper_evidence | WBPaper00004312 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
"The expression of pal-1 in V6 requires a V6-specific cis regulatory element located in the last pal-1 intron. The regulatory mutation pal-1(e2091) contains a point mutation within this putative enhancer that prevents V6 expression (Hunter et_al, 1999; Zhang and Emmons, 2000). As a result, mab-5 and its downstream targets are not activated and the V6 cell lineage is transformed to one resembling an anterior seam cell lineage (Waring and Kenyon, 1990; Hunter et_al, 1999); instead of rays 2-6, V6 generates longitudinal cuticular ridges, termed alae, normally found along the body only anterior of the ray domain (Pal phenotype, for posterior alae) (Fig 1B)." | Paper_evidence | WBPaper00004616 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Penetrance | High | 96% penetrance | Paper_evidence | WBPaper00004312 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006941 | PATO:0000460 | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0004875 | PATO:0000460 | Paper_evidence | WBPaper00004312 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0004874 | PATO:0000460 | Paper_evidence | WBPaper00004312 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0006945 | PATO:0000460 | Paper_evidence | WBPaper00004312 | ||||||
WBPaper00004616 | |||||||||
WBPaper00004853 | |||||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0006948 | PATO:0000460 | Paper_evidence | WBPaper00004312 | ||||||
WBPaper00004616 | |||||||||
WBPaper00004853 | |||||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0006949 | PATO:0000460 | Paper_evidence | WBPaper00004312 | ||||||
WBPaper00004616 | |||||||||
WBPaper00004853 | |||||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0006950 | PATO:0000460 | Paper_evidence | WBPaper00004312 | ||||||
WBPaper00004616 | |||||||||
WBPaper00004853 | |||||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0006951 | PATO:0000460 | Paper_evidence | WBPaper00004312 | ||||||
WBPaper00004616 | |||||||||
WBPaper00004853 | |||||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001693 | Paper_evidence | WBPaper00004312 | |||||||
WBPaper00004616 | |||||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPerson2987 | |||||||||
Remark | Alae extend into tail region. | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
In pal-1(e2091) mutants the V6 cell adopts a fate similar to anterior seam cells V1-V4 in wild type, producing alae instead of rays. | Paper_evidence | WBPaper00004312 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
"The expression of pal-1 in V6 requires a V6-specific cis regulatory element located in the last pal-1 intron. The regulatory mutation pal-1(e2091) contains a point mutation within this putative enhancer that prevents V6 expression (Hunter et_al, 1999; Zhang and Emmons, 2000). As a result, mab-5 and its downstream targets are not activated and the V6 cell lineage is transformed to one resembling an anterior seam cell lineage (Waring and Kenyon, 1990; Hunter et_al, 1999); instead of rays 2-6, V6 generates longitudinal cuticular ridges, termed alae, normally found along the body only anterior of the ray domain (Pal phenotype, for posterior alae) (Fig 1B)." | Paper_evidence | WBPaper00004616 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006941 | PATO:0000460 | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0006914 | PATO:0000460 | Paper_evidence | WBPaper00004312 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0007832 | PATO:0000460 | Paper_evidence | WBPaper00004312 | ||||||
WBPaper00004616 | |||||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0004875 | PATO:0000460 | Paper_evidence | WBPaper00004312 | ||||||
WBPaper00004616 | |||||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0004874 | PATO:0000460 | Paper_evidence | WBPaper00004312 | ||||||
WBPaper00004616 | |||||||||
Curator_confirmed | WBPerson2987 | ||||||||
Reference (21) | |||||||||
Remark | Curated Sequence_details based on WBPaper00004312 | Paper_evidence | WBPaper00004312 | ||||||
Curator_confirmed | WBPerson51134 | ||||||||
Method | Substitution_allele |