WormBase Tree Display for Variation: WBVar00144297
expand all nodes | collapse all nodes | view schema
WBVar00144297 | Name | Public_name | e1778 | ||
---|---|---|---|---|---|
Other_name | T19E10.1a.2:c.334_623del | ||||
CE18264:p.Arg112TrpfsTer4 | |||||
T19E10.1a.1:c.334_623del | |||||
T19E10.1b.1:c.334_623del | |||||
CE01671:p.Arg112TrpfsTer4 | |||||
HGVSg | CHROMOSOME_II:g.10782318_10782823del | ||||
Sequence_details | SMap | S_parent | Sequence | T19E10 | |
Flanking_sequences | aagaataggctgagtccttcaaatacgcca | ggcagctcgcaacgtcatcaaatcctgcaa | |||
Mapping_target | T19E10 | ||||
Type_of_mutation | Deletion | ||||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain (2) | |||||
Laboratory | CB | ||||
Status | Live | ||||
Affects | Gene | WBGene00002297 | |||
Transcript | T19E10.1b.1 (11) | ||||
T19E10.1a.2 (11) | |||||
T19E10.1a.1 (11) | |||||
Genetics | Interpolated_map_position | II | 3.1257 | ||
Mapping_data | In_2_point | 706 | |||
In_multi_point | 591 | ||||
In_pos_neg_data | 7149 | ||||
Description | Phenotype (4) | ||||
Reference | WBPaper00012484 | ||||
WBPaper00023163 | |||||
Remark | e1771 appears in legend of fig 1A in WBPaper00026774 but the allele actually described in the figure is e1778 | Paper_evidence | WBPaper00026774 | ||
Curator_confirmed | WBPerson2970 | ||||
Method | Deletion_allele |