WormBase Tree Display for Variation: WBVar00144296
expand all nodes | collapse all nodes | view schema
WBVar00144296 | Name | Public_name | e1777 | ||||||
---|---|---|---|---|---|---|---|---|---|
Other_name (5) | |||||||||
HGVSg | CHROMOSOME_IV:g.2277404G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | C37F5 | |||||
Flanking_sequences | ccgtcaatctcgtctccacttctgatgctt | agcaacaccatcaaaactccccgctattcc | |||||||
Mapping_target | C37F5 | ||||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00002352 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin (4) | |||||||||
Affects | Gene | WBGene00002990 | |||||||
Transcript | C37F5.1a.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | C37F5.1a.1:c.925C>T | ||||||||
HGVSp | CE31440:p.Gln309Ter | ||||||||
cDNA_position | 925 | ||||||||
CDS_position | 925 | ||||||||
Protein_position | 309 | ||||||||
Exon_number | 5/7 | ||||||||
Codon_change | Cag/Tag | ||||||||
Amino_acid_change | Q/* | ||||||||
C37F5.1b.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | C37F5.1b.1:c.805C>T | ||||||||
HGVSp | CE27833:p.Gln269Ter | ||||||||
cDNA_position | 813 | ||||||||
CDS_position | 805 | ||||||||
Protein_position | 269 | ||||||||
Exon_number | 4/6 | ||||||||
Codon_change | Cag/Tag | ||||||||
Amino_acid_change | Q/* | ||||||||
Interactor | WBInteraction000001242 | ||||||||
WBInteraction000502389 | |||||||||
WBInteraction000504230 | |||||||||
WBInteraction000541772 | |||||||||
WBInteraction000542312 | |||||||||
WBInteraction000542313 | |||||||||
WBInteraction000542314 | |||||||||
Genetics | Interpolated_map_position | IV | -8.49046 | ||||||
Mapping_data | In_2_point | 3277 | |||||||
5217 | |||||||||
6179 | |||||||||
6185 | |||||||||
In_multi_point | 1270 | ||||||||
1842 | |||||||||
2438 | |||||||||
2440 | |||||||||
Description | Phenotype | WBPhenotype:0000038 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | often bursts at abnormal vulva during L4 molt | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000216 | Paper_evidence | WBPaper00035553 | |||||||
Curator_confirmed | WBPerson625 | ||||||||
Remark | defect in Bγ cell fate specification | Paper_evidence | WBPaper00035553 | ||||||
Curator_confirmed | WBPerson625 | ||||||||
defect in Bδ cell fate specification | Paper_evidence | WBPaper00035553 | |||||||
Curator_confirmed | WBPerson625 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0007830 | PATO:0000460 | Paper_evidence | WBPaper00035553 | ||||
Curator_confirmed | WBPerson625 | ||||||||
WBbt:0008451 | PATO:0000460 | Paper_evidence | WBPaper00035553 | ||||||
Curator_confirmed | WBPerson625 | ||||||||
GO_term | GO:0001708 | PATO:0000460 | Paper_evidence | WBPaper00035553 | |||||
Curator_confirmed | WBPerson625 | ||||||||
Phenotype_assay | Control_strain | WBStrain00044748 | Paper_evidence | WBPaper00035553 | |||||
Curator_confirmed | WBPerson625 | ||||||||
Treatment | ceh-13::gfp as marker of Bγ cell fate syIs145 PS4807 contains the ceh-13::GFP integrated transgene syIs145 that was obtained by microinjection of pMF1 at 10 ng/μl, pBS at 20 ng/μl and unc-119(+) at 40 ng/μl into unc-119(ed4); him-5(e1490) mutant animals. | Paper_evidence | WBPaper00035553 | ||||||
Curator_confirmed | WBPerson625 | ||||||||
Genotype | sIys145 [ceh-13::GFP] | Paper_evidence | WBPaper00035553 | ||||||
Curator_confirmed | WBPerson625 | ||||||||
WBPhenotype:0000700 | Paper_evidence | WBPaper00000762 | |||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPerson712 | |||||||||
Remark | adult hermaphrodite has multiple (one to four) vulval protrusions; easy to score (ES3) in adult, very hard to score (ES1) in larvae | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00000762 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00000762 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00000762 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Ease_of_scoring | ES3_Easy_to_score | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001276 | Paper_evidence | WBPaper00027035 | |||||||
WBPaper00035553 | |||||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPerson625 | |||||||||
Remark | "To assess the mechanism of lin-39 upregulation in lin-1 loss-of-function mutants, we analyzed lin-1(e1777); deIs1 and lin-1(e1777); deIs4 strains, and found that in a lin-1(e1777) mutant background, the GFP levels increased significantly in P5.p-P8.p after vulval induction for the transcriptional fusion (Fig. 9B)." | Paper_evidence | WBPaper00027035 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
syIs45 expressed in Bδ (abnormal spicule development) | Paper_evidence | WBPaper00035553 | |||||||
Curator_confirmed | WBPerson625 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0008451 | PATO:0000460 | Paper_evidence | WBPaper00035553 | ||||
Curator_confirmed | WBPerson625 | ||||||||
GO_term | GO:0010467 | PATO:0000460 | Paper_evidence | WBPaper00035553 | |||||
Curator_confirmed | WBPerson625 | ||||||||
Phenotype_assay | Control_strain | WBStrain00044748 | Paper_evidence | WBPaper00035553 | |||||
Curator_confirmed | WBPerson625 | ||||||||
Treatment | ceh-13::gfp as marker of Bγ cell fate syIs145 PS4807 contains the ceh-13::GFP integrated transgene syIs145 that was obtained by microinjection of pMF1 at 10 ng/μl, pBS at 20 ng/μl and unc-119(+) at 40 ng/μl into unc-119(ed4); him-5(e1490) mutant animals. | Paper_evidence | WBPaper00035553 | ||||||
Curator_confirmed | WBPerson625 | ||||||||
Genotype | lin-39::GFP | Paper_evidence | WBPaper00027035 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
sIys145 [ceh-13::GFP] | Paper_evidence | WBPaper00035553 | |||||||
Curator_confirmed | WBPerson625 | ||||||||
WBPhenotype:0001278 | Paper_evidence | WBPaper00035553 | |||||||
Curator_confirmed | WBPerson625 | ||||||||
Remark | decreased sIys145 expression in Bγ | Paper_evidence | WBPaper00035553 | ||||||
Curator_confirmed | WBPerson625 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0007830 | PATO:0000460 | Paper_evidence | WBPaper00035553 | ||||
Curator_confirmed | WBPerson625 | ||||||||
GO_term | GO:0010467 | PATO:0000460 | Paper_evidence | WBPaper00035553 | |||||
Curator_confirmed | WBPerson625 | ||||||||
Phenotype_assay | Control_strain | WBStrain00044748 | Paper_evidence | WBPaper00035553 | |||||
Curator_confirmed | WBPerson625 | ||||||||
Treatment | ceh-13::gfp as marker of Bγ cell fate syIs145 PS4807 contains the ceh-13::GFP integrated transgene syIs145 that was obtained by microinjection of pMF1 at 10 ng/μl, pBS at 20 ng/μl and unc-119(+) at 40 ng/μl into unc-119(ed4); him-5(e1490) mutant animals. | Paper_evidence | WBPaper00035553 | ||||||
Curator_confirmed | WBPerson625 | ||||||||
Genotype | sIys145 [ceh-13::GFP] | Paper_evidence | WBPaper00035553 | ||||||
Curator_confirmed | WBPerson625 | ||||||||
WBPhenotype:0001305 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | adult male has rudimentary ectopic hooks; very hard to score (ES1) | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Ease_of_scoring | ES1_Very_hard_to_score | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001414 | Paper_evidence | WBPaper00000762 | |||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPerson712 | |||||||||
Remark | male mating is completely abolished | Paper_evidence | WBPaper00000762 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Penetrance | High | Paper_evidence | WBPaper00000762 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00000762 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00000762 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00000762 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | him-5(e1467) | Paper_evidence | WBPaper00000762 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001487 | Paper_evidence | WBPaper00035553 | |||||||
Curator_confirmed | WBPerson625 | ||||||||
Remark | syIs45 expressed in Bδ (abnormal spicule development) | Paper_evidence | WBPaper00035553 | ||||||
Curator_confirmed | WBPerson625 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0008451 | PATO:0000460 | Paper_evidence | WBPaper00035553 | ||||
Curator_confirmed | WBPerson625 | ||||||||
GO_term | GO:0048608 | PATO:0000460 | Paper_evidence | WBPaper00035553 | |||||
Curator_confirmed | WBPerson625 | ||||||||
Phenotype_assay | Control_strain | WBStrain00044748 | Paper_evidence | WBPaper00035553 | |||||
Curator_confirmed | WBPerson625 | ||||||||
Treatment | ceh-13::gfp as marker of Bγ cell fate syIs145 PS4807 contains the ceh-13::GFP integrated transgene syIs145 that was obtained by microinjection of pMF1 at 10 ng/μl, pBS at 20 ng/μl and unc-119(+) at 40 ng/μl into unc-119(ed4); him-5(e1490) mutant animals. | Paper_evidence | WBPaper00035553 | ||||||
Curator_confirmed | WBPerson625 | ||||||||
Genotype | sIys145 [ceh-13::GFP] | Paper_evidence | WBPaper00035553 | ||||||
Curator_confirmed | WBPerson625 | ||||||||
Phenotype_not_observed | WBPhenotype:0000717 | Paper_evidence | WBPaper00032994 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Mutants showed wildtype dat-1::gfp expression | Paper_evidence | WBPaper00032994 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | vtIs1 (dat-1::gfp;rol6) | Paper_evidence | WBPaper00032994 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001060 | Paper_evidence | WBPaper00003955 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001061 | Paper_evidence | WBPaper00003955 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005670 | PATO:0000460 | Paper_evidence | WBPaper00003955 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00027035 | ||||||||
WBPaper00035553 | |||||||||
WBPaper00032994 | |||||||||
WBPaper00013779 | |||||||||
WBPaper00012430 | |||||||||
WBPaper00000762 | |||||||||
WBPaper00014073 | |||||||||
WBPaper00013862 | |||||||||
WBPaper00003955 | |||||||||
Method | Substitution_allele |