WormBase Tree Display for Variation: WBVar00144039
expand all nodes | collapse all nodes | view schema
WBVar00144039 | Evidence | Person_evidence | WBPerson25803 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | e1490 | |||||||
Other_name | D1086.4a.1:c.277-1G>A | ||||||||
HGVSg | CHROMOSOME_V:g.14091472G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | D1086 | |||||
Flanking_sequences | aaaacatggaattttactgattattttcca | gcaaagctccggaaagctaactccaagtat | |||||||
Mapping_target | D1086 | ||||||||
Type_of_mutation | Substitution | g | a | ||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain (516) | |||||||||
Laboratory | CB | ||||||||
HZ | |||||||||
OH | |||||||||
AD | |||||||||
DR | |||||||||
SL | |||||||||
ARK | |||||||||
CHB | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00001864 | |||||||
Transcript | D1086.4a.1 | VEP_consequence | splice_acceptor_variant | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | D1086.4a.1:c.277-1G>A | ||||||||
Intron_number | 4/8 | ||||||||
Interactor | WBInteraction000501188 | ||||||||
Genetics | Interpolated_map_position | V | 6.09222 | ||||||
Mapping_data | In_2_point | 6177 | |||||||
In_multi_point (16) | |||||||||
In_pos_neg_data (2) | |||||||||
Description | Phenotype | WBPhenotype:0000044 | Paper_evidence | WBPaper00049555 | |||||
Curator_confirmed | WBPerson137 | ||||||||
WBPhenotype:0000050 | Paper_evidence | WBPaper00000179 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | 14.1% eggs never hatch, yet are refractile; wild type animals produce 0.8% inviable zygotes. | Paper_evidence | WBPaper00000179 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000057 | Paper_evidence | WBPaper00049555 | |||||||
Curator_confirmed | WBPerson137 | ||||||||
WBPhenotype:0000154 | Paper_evidence | WBPaper00000179 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals segregate a small percentage (0.8%) of short animals shown to be 3X hermaphrodites (wild type segregates 0.04% 3X herm.). | Paper_evidence | WBPaper00000179 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00000179 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000351 | Paper_evidence | WBPaper00003719 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
Remark | X-aneuploid progeny fail to hatch (see Hodgkin et. al. 1979). | Paper_evidence | WBPaper00003719 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
Penetrance | Low | Paper_evidence | WBPaper00003719 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
Range | 5 | 5 | Paper_evidence | WBPaper00003719 | |||||
Curator_confirmed | WBPerson48 | ||||||||
WBPhenotype:0000863 | Paper_evidence | WBPaper00000179 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Males exhibit 55.2% wild type fertility. | Paper_evidence | WBPaper00000179 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00000179 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001175 | Paper_evidence | WBPaper00000179 | |||||||
WBPaper00048917 | |||||||||
WBPaper00049555 | |||||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPerson721 | |||||||||
WBPerson137 | |||||||||
Remark | Animals segregate 32.9% males compared to 0.3% segregated by wild type animals. | Paper_evidence | WBPaper00000179 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
stronger allele : 33% Him at 20C | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 20 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001583 | Paper_evidence | WBPaper00000179 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals segregate a small percentage (6.7%) of short animals shown to be 3X hermaphrodites (wild type segregates 0.04% 3X herm.). | Paper_evidence | WBPaper00000179 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00000179 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed (10) | |||||||||
Reference (58) | |||||||||
Remark | alt_det = g to a mut_det = ag to aa | Person_evidence | WBPerson25803 | ||||||
Curator_confirmed | WBPerson51134 | ||||||||
Variation information submitted by WBPerson25803 on 2023-10-13_08:12:53 via the Allele submission form. | Curator_confirmed | WBPerson51134 | |||||||
Method | Substitution_allele |