WormBase Tree Display for Variation: WBVar00144039
expand all nodes | collapse all nodes | view schema
WBVar00144039 | Evidence | Person_evidence | WBPerson25803 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | e1490 | |||||||
Other_name | D1086.4a.1:c.277-1G>A | ||||||||
HGVSg | CHROMOSOME_V:g.14091472G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | D1086 | |||||
Flanking_sequences | aaaacatggaattttactgattattttcca | gcaaagctccggaaagctaactccaagtat | |||||||
Mapping_target | D1086 | ||||||||
Type_of_mutation | Substitution | g | a | ||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain (516) | |||||||||
Laboratory | CB | ||||||||
HZ | |||||||||
OH | |||||||||
AD | |||||||||
DR | |||||||||
SL | |||||||||
ARK | |||||||||
CHB | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00001864 | |||||||
Transcript | D1086.4a.1 | VEP_consequence | splice_acceptor_variant | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | D1086.4a.1:c.277-1G>A | ||||||||
Intron_number | 4/8 | ||||||||
Interactor | WBInteraction000501188 | ||||||||
Genetics | Interpolated_map_position | V | 6.09222 | ||||||
Mapping_data | In_2_point | 6177 | |||||||
In_multi_point (16) | |||||||||
In_pos_neg_data (2) | |||||||||
Description | Phenotype | WBPhenotype:0000044 | Paper_evidence | WBPaper00049555 | |||||
Curator_confirmed | WBPerson137 | ||||||||
WBPhenotype:0000050 | Paper_evidence | WBPaper00000179 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | 14.1% eggs never hatch, yet are refractile; wild type animals produce 0.8% inviable zygotes. | Paper_evidence | WBPaper00000179 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000057 | Paper_evidence | WBPaper00049555 | |||||||
Curator_confirmed | WBPerson137 | ||||||||
WBPhenotype:0000154 | Paper_evidence | WBPaper00000179 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals segregate a small percentage (0.8%) of short animals shown to be 3X hermaphrodites (wild type segregates 0.04% 3X herm.). | Paper_evidence | WBPaper00000179 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00000179 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000351 | Paper_evidence | WBPaper00003719 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
Remark | X-aneuploid progeny fail to hatch (see Hodgkin et. al. 1979). | Paper_evidence | WBPaper00003719 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
Penetrance | Low | Paper_evidence | WBPaper00003719 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
Range | 5 | 5 | Paper_evidence | WBPaper00003719 | |||||
Curator_confirmed | WBPerson48 | ||||||||
WBPhenotype:0000863 | Paper_evidence | WBPaper00000179 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Males exhibit 55.2% wild type fertility. | Paper_evidence | WBPaper00000179 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00000179 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001175 | Paper_evidence | WBPaper00000179 | |||||||
WBPaper00048917 | |||||||||
WBPaper00049555 | |||||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed (3) | |||||||||
Remark | Animals segregate 32.9% males compared to 0.3% segregated by wild type animals. | Paper_evidence | WBPaper00000179 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
stronger allele : 33% Him at 20C | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 20 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001583 | Paper_evidence | WBPaper00000179 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals segregate a small percentage (6.7%) of short animals shown to be 3X hermaphrodites (wild type segregates 0.04% 3X herm.). | Paper_evidence | WBPaper00000179 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00000179 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0000517 | Paper_evidence | WBPaper00000179 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals are indistinguishable from wild type in terms of behavior. | Paper_evidence | WBPaper00000179 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000520 | Paper_evidence | WBPaper00000179 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Both hermaphrodites and males are indistinguishable from wild type in terms of superficial anatomy. | Paper_evidence | WBPaper00000179 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000843 | Paper_evidence | WBPaper00031689 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Mating efficiency is not significantly different from control animals. | Paper_evidence | WBPaper00031689 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | For each trial, six males and two dpy-17(e904) hermaphrodites were placed on a plate. | Paper_evidence | WBPaper00031689 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001426 | Paper_evidence | WBPaper00004883 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | arIs37 | Paper_evidence | WBPaper00004883 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001431 | Paper_evidence | WBPaper00027716 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
Phenotype_assay | Temperature | 25 | Paper_evidence | WBPaper00027716 | |||||
Curator_confirmed | WBPerson48 | ||||||||
WBPhenotype:0001522 | Paper_evidence | WBPaper00031871 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Spicules of non-mating males remained in the normal retracted position. Treatment with a dihydropiridine (DHP) analog did not elicit continuous spicule protraction. | Paper_evidence | WBPaper00031871 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005312 | PATO:0000460 | Paper_evidence | WBPaper00031871 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00031871 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | nemadipine | Paper_evidence | WBPaper00031871 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001631 | Paper_evidence | WBPaper00000179 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | The sex ratio of cross progeny sired by him males does not significantly differ from 1:1. | Paper_evidence | WBPaper00000179 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00000179 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0002140 | Paper_evidence | WBPaper00032050 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Males responded to ascr#3, an ascaroside, in male attraction assays. | Paper_evidence | WBPaper00032050 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0002535 | Paper_evidence | WBPaper00031689 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals do not exhibit DiI filling defects. | Paper_evidence | WBPaper00031689 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0004004 | Paper_evidence | WBPaper00031689 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Male response efficiency was not significantly different from control animals. | Paper_evidence | WBPaper00031689 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Each trial consists of 10-25 males. Males were assayed 4 minutes after contact. | Paper_evidence | WBPaper00031689 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Reference (58) | |||||||||
Remark | alt_det = g to a mut_det = ag to aa | Person_evidence | WBPerson25803 | ||||||
Curator_confirmed | WBPerson51134 | ||||||||
Variation information submitted by WBPerson25803 on 2023-10-13_08:12:53 via the Allele submission form. | Curator_confirmed | WBPerson51134 | |||||||
Method | Substitution_allele |