WormBase Tree Display for Variation: WBVar00143992
expand all nodes | collapse all nodes | view schema
WBVar00143992 | Evidence | Paper_evidence | WBPaper00006370 | ||||||
---|---|---|---|---|---|---|---|---|---|
Person_evidence | WBPerson625 | ||||||||
Name | Public_name | e1417 | |||||||
Other_name | F36H1.4h.2:c.56-209C>T | ||||||||
F36H1.4b.1:c.56-209C>T | |||||||||
F36H1.4g.1:c.56-203C>T | |||||||||
F36H1.4d.1:c.56-209C>T | |||||||||
F36H1.4b.3:c.56-209C>T | |||||||||
F36H1.4c.1:c.56-203C>T | |||||||||
F36H1.4h.1:c.56-209C>T | |||||||||
F36H1.4a.1:c.56-203C>T | |||||||||
F36H1.4b.2:c.56-209C>T | |||||||||
F36H1.4f.1:c.56-209C>T | |||||||||
HGVSg | CHROMOSOME_IV:g.11059196C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | F36H1 | |||||
Flanking_sequences | tgctggttttttcttgtgac | ctgaaaactgtacacacaggtg | |||||||
Mapping_target | F36H1 | ||||||||
Type_of_mutation | Substitution | C | T | Person_evidence | WBPerson625 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00004330 | ||||||||
WBStrain00026836 | |||||||||
WBStrain00040217 | |||||||||
Laboratory | CB | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00002992 | |||||||
Transcript | F36H1.4g.1 | VEP_consequence | intron_variant | ||||||
VEP_impact | MODIFIER | ||||||||
HGVSc | F36H1.4g.1:c.56-203C>T | ||||||||
Intron_number | 4/13 | ||||||||
F36H1.4b.3 | VEP_consequence | intron_variant | |||||||
VEP_impact | MODIFIER | ||||||||
HGVSc | F36H1.4b.3:c.56-209C>T | ||||||||
Intron_number | 2/10 | ||||||||
F36H1.4d.1 | VEP_consequence | intron_variant | |||||||
VEP_impact | MODIFIER | ||||||||
HGVSc | F36H1.4d.1:c.56-209C>T | ||||||||
Intron_number | 3/13 | ||||||||
F36H1.4f.1 | VEP_consequence | intron_variant | |||||||
VEP_impact | MODIFIER | ||||||||
HGVSc | F36H1.4f.1:c.56-209C>T | ||||||||
Intron_number | 1/10 | ||||||||
F36H1.4b.1 | VEP_consequence | intron_variant | |||||||
VEP_impact | MODIFIER | ||||||||
HGVSc | F36H1.4b.1:c.56-209C>T | ||||||||
Intron_number | 3/12 | ||||||||
F36H1.4c.1 | VEP_consequence | intron_variant | |||||||
VEP_impact | MODIFIER | ||||||||
HGVSc | F36H1.4c.1:c.56-203C>T | ||||||||
Intron_number | 4/13 | ||||||||
F36H1.4a.1 | VEP_consequence | intron_variant | |||||||
VEP_impact | MODIFIER | ||||||||
HGVSc | F36H1.4a.1:c.56-203C>T | ||||||||
Intron_number | 4/13 | ||||||||
F36H1.4h.2 | VEP_consequence | intron_variant | |||||||
VEP_impact | MODIFIER | ||||||||
HGVSc | F36H1.4h.2:c.56-209C>T | ||||||||
Intron_number | 3/12 | ||||||||
F36H1.4h.1 | VEP_consequence | intron_variant | |||||||
VEP_impact | MODIFIER | ||||||||
HGVSc | F36H1.4h.1:c.56-209C>T | ||||||||
Intron_number | 4/13 | ||||||||
F36H1.4b.2 | VEP_consequence | intron_variant | |||||||
VEP_impact | MODIFIER | ||||||||
HGVSc | F36H1.4b.2:c.56-209C>T | ||||||||
Intron_number | 4/13 | ||||||||
Interactor | WBInteraction000009223 | ||||||||
WBInteraction000500498 | |||||||||
WBInteraction000524354 | |||||||||
WBInteraction000524526 | |||||||||
WBInteraction000538539 | |||||||||
WBInteraction000538543 | |||||||||
WBInteraction000556184 | |||||||||
Isolation | Mutagen | EMS | |||||||
Forward_genetics | standard phenotypic screen | ||||||||
Genetics (2) | |||||||||
Description | Phenotype | WBPhenotype:0000219 | Paper_evidence | WBPaper00031110 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Underinduced animals (worms with fewer than three VPCs induced) were detected. | Paper_evidence | WBPaper00031110 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 20 | Paper_evidence | WBPaper00031110 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000698 | Paper_evidence | WBPaper00000762 | |||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPerson712 | |||||||||
Remark | 16 percent of Vul hermaphrodites have a single ventral protrusion | Paper_evidence | WBPaper00000762 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
adult hermaphrodite vulvaless (penetrance 89%); adult male wildtype | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | High | Paper_evidence | WBPaper00000762 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Range | 89 | 89 | Paper_evidence | WBPaper00000762 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00000762 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00000762 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00000762 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Temperature | 20 | Paper_evidence | WBPaper00000762 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_not_observed | WBPhenotype:0000195 | Paper_evidence | WBPaper00005809 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Table 3 | Paper_evidence | WBPaper00005809 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
"In contrast to the results with an unc-5 hypomorphic allele, the frequency of DTC migration defects of an unc-5 null allele was not significantly increased by any of the mutations in genes encoding growth factor-like molecules that we examined (Table 3)." | Paper_evidence | WBPaper00005809 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006865 | PATO:0000460 | Paper_evidence | WBPaper00005809 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
GO_term | GO:0016477 | PATO:0000460 | Paper_evidence | WBPaper00005809 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype (2) | ||||||||
WBPhenotype:0001278 | Paper_evidence | WBPaper00057074 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | neurons did not show a loss in unc-25::GFP expression | Paper_evidence | WBPaper00057074 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Image | WBPicture0000014913 | Paper_evidence | WBPaper00057074 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005027 | PATO:0000460 | Paper_evidence | WBPaper00057074 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0005021 | PATO:0000460 | Paper_evidence | WBPaper00057074 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Reference (13) | |||||||||
Remark | N2 tgctggttttttcttgtgaccctgaaaactgtacacacaggtg | ||||||||
Method | Substitution_allele |