WormBase Tree Display for Variation: WBVar00143911
expand all nodes | collapse all nodes | view schema
WBVar00143911 | Evidence | Paper_evidence | WBPaper00002741 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | e1313 | |||||||
Other_name | CE26435:p.Trp73Ter | ||||||||
F38G1.2.2:c.218G>A | |||||||||
F38G1.2.1:c.218G>A | |||||||||
HGVSg | CHROMOSOME_X:g.490824G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | F38G1 | |||||
Flanking_sequences | ttgtagccgattggaatgtggttggagaat | ggatggaaagtttcggttacaacatgcaca | |||||||
Mapping_target | F38G1 | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00002741 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain (5) | |||||||||
Laboratory | CB | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00001185 | |||||||
Transcript | F38G1.2.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | F38G1.2.1:c.218G>A | ||||||||
HGVSp | CE26435:p.Trp73Ter | ||||||||
cDNA_position | 281 | ||||||||
CDS_position | 218 | ||||||||
Protein_position | 73 | ||||||||
Exon_number | 5/8 | ||||||||
Codon_change | tGg/tAg | ||||||||
Amino_acid_change | W/* | ||||||||
F38G1.2.2 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | F38G1.2.2:c.218G>A | ||||||||
HGVSp | CE26435:p.Trp73Ter | ||||||||
cDNA_position | 238 | ||||||||
CDS_position | 218 | ||||||||
Protein_position | 73 | ||||||||
Exon_number | 4/7 | ||||||||
Codon_change | tGg/tAg | ||||||||
Amino_acid_change | W/* | ||||||||
Interactor | WBInteraction000519127 | ||||||||
WBInteraction000519835 | |||||||||
WBInteraction000535556 | |||||||||
WBInteraction000538540 | |||||||||
WBInteraction000538544 | |||||||||
WBInteraction000538551 | |||||||||
WBInteraction000538555 | |||||||||
Genetics | Interpolated_map_position | X | -19.7039 | ||||||
Mapping_data | In_2_point | 4453 | |||||||
6176 | |||||||||
In_multi_point (11) | |||||||||
Description | Phenotype (21) | ||||||||
Phenotype_not_observed | WBPhenotype:0000195 | Paper_evidence | WBPaper00005809 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Table 3 | Paper_evidence | WBPaper00005809 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
"In contrast to the results with an unc-5 hypomorphic allele, the frequency of DTC migration defects of an unc-5 null allele was not significantly increased by any of the mutations in genes encoding growth factor-like molecules that we examined (Table 3)." | Paper_evidence | WBPaper00005809 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations (2) | |||||||||
Phenotype_assay | Genotype | unc-5(e152) | Paper_evidence | WBPaper00005809 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
unc-5(e53) | Paper_evidence | WBPaper00005809 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001336 | Paper_evidence | WBPaper00000635 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
Phenotype_assay | Treatment | As described in Hodgkin, Horvitz, and Brenner (1979), six L4 males and six L4 dpy-11 hermaphrodites incubated for 24 hours, males removed, and hermaphrodites transferred to fresh dishes each day. Cross-progeny are counted. | Paper_evidence | WBPaper00000635 | |||||
Curator_confirmed | WBPerson48 | ||||||||
WBPhenotype:0001652 | Paper_evidence | WBPaper00032446 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0002193 | Paper_evidence | WBPaper00044058 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "No allele of egl-17, egl-15 or any other downstream FGF component other than sem-5 had any effect on orientation as single mutants (Table 1), which is probably due to the involvement of sem-5 in one of the other pathways controlling vulval orientation as well as its role in the FGF pathway." | Paper_evidence | WBPaper00044058 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006895 | PATO:0000460 | Paper_evidence | WBPaper00044058 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
Reference | WBPaper00043908 | ||||||||
WBPaper00032446 | |||||||||
WBPaper00000635 | |||||||||
WBPaper00005809 | |||||||||
WBPaper00013863 | |||||||||
WBPaper00013708 | |||||||||
WBPaper00002741 | |||||||||
WBPaper00014797 | |||||||||
WBPaper00044058 | |||||||||
Method | Substitution_allele |