WormBase Tree Display for Variation: WBVar00143773
expand all nodes | collapse all nodes | view schema
WBVar00143773 | Evidence | Person_evidence | WBPerson384 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | e1141 | |||||||
Other_name | e1114 | Person_evidence | WBPerson384 | ||||||
CE05795:p.Thr66Ile | |||||||||
F32G8.6.1:c.197C>T | |||||||||
HGVSg | CHROMOSOME_V:g.10565677C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | F32G8 | |||||
Flanking_sequences | caggagaagacatcaatcgtcagggacttctgaaaa | tccagaacgtgctgccaaagcaatgatggcattcac | |||||||
Mapping_target | F32G8 | ||||||||
Type_of_mutation | Substitution | c | t | ||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00004253 | ||||||||
WBStrain00004816 | |||||||||
WBStrain00027351 | |||||||||
Laboratory | CB | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00000298 | |||||||
Transcript | F32G8.6.1 (12) | ||||||||
Interactor (2) | |||||||||
Genetics | Interpolated_map_position | V | 2.59941 | ||||||
Mapping_data | In_multi_point | 151 | |||||||
1529 | |||||||||
2269 | |||||||||
In_pos_neg_data (5) | |||||||||
Description | Phenotype (29) | ||||||||
Phenotype_not_observed | WBPhenotype:0000456 | Paper_evidence | WBPaper00000365 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000525 | Paper_evidence | WBPaper00001861 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001206 | Paper_evidence | WBPaper00001861 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001765 | Paper_evidence | WBPaper00031936 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Mutants defective in the synthesis and reception of nonessential excitatory neurotransmitters respond normally to CO2 | Paper_evidence | WBPaper00031936 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00031936 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | 10% CO2 | Paper_evidence | WBPaper00031936 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001780 | Paper_evidence | WBPaper00029060 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Mutants show normal butanone enhancement | Paper_evidence | WBPaper00029060 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00029060 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | Preexposure to 1:10 dilution of butanone and food. Animals were then subjected to odorant chemotaxis assays and/or selection assays | Paper_evidence | WBPaper00029060 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference (17) | |||||||||
Method | Substitution_allele |