WormBase Tree Display for Variation: WBVar00143714
expand all nodes | collapse all nodes | view schema
WBVar00143714 | Name | Public_name | e1062 | ||||||
---|---|---|---|---|---|---|---|---|---|
Other_name | F14F3.1a.1:c.445C>T | ||||||||
F14F3.1a.2:c.445C>T | |||||||||
CE24899:p.Arg149Ter | |||||||||
HGVSg | CHROMOSOME_X:g.10511402C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | F14F3 | |||||
Flanking_sequences | acaatgcaaacagagctttacgatagaatt | gaatagttgataactttccgtaagtttcaa | |||||||
Mapping_target | F14F3 | ||||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00024640 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00004234 | ||||||||
Laboratory | CB | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00006870 | |||||||
Transcript | F14F3.1a.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | F14F3.1a.1:c.445C>T | ||||||||
HGVSp | CE24899:p.Arg149Ter | ||||||||
cDNA_position | 747 | ||||||||
CDS_position | 445 | ||||||||
Protein_position | 149 | ||||||||
Exon_number | 7/14 | ||||||||
Codon_change | Cga/Tga | ||||||||
Amino_acid_change | R/* | ||||||||
F14F3.1a.2 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | F14F3.1a.2:c.445C>T | ||||||||
HGVSp | CE24899:p.Arg149Ter | ||||||||
cDNA_position | 537 | ||||||||
CDS_position | 445 | ||||||||
Protein_position | 149 | ||||||||
Exon_number | 6/13 | ||||||||
Codon_change | Cga/Tga | ||||||||
Amino_acid_change | R/* | ||||||||
Isolation | Mutagen | EMS | Paper_evidence | WBPaper00024640 | |||||
Genetics | Interpolated_map_position | X | 2.22424 | ||||||
Description | Phenotype | WBPhenotype:0000071 | Paper_evidence | WBPaper00000214 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Mutants have grossly deformed heads. | Paper_evidence | WBPaper00000214 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000247 | Paper_evidence | WBPaper00000214 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Mutants are 30% responsive to Na+ in a behavior orientation assay. WT worms are 95% responsive (based on sustained distance from attractant). | Paper_evidence | WBPaper00000214 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000254 | Paper_evidence | WBPaper00000214 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Mutants behave like WT in a Cl- gradient selection assay; however they are 15% responsive to Cl- in behavior orientation assay (based on sustained distance from attractant), WT are 70% responsive. | Paper_evidence | WBPaper00000214 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000256 | Paper_evidence | WBPaper00000214 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Relative positions of the amphidial nerve types a through l are often distorted with respect to one another; one or both amphidial complexes may rotated 180 about the longitudinal axis. | Paper_evidence | WBPaper00000214 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000342 | Paper_evidence | WBPaper00000214 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | The bursa is deformed. | Paper_evidence | WBPaper00000214 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00000214 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000637 | Paper_evidence | WBPaper00000214 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000863 | Paper_evidence | WBPaper00000214 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Mutant males are less potent than WT. | Paper_evidence | WBPaper00000214 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001528 | Paper_evidence | WBPaper00000214 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Sheath and socket cells fail to form. | Paper_evidence | WBPaper00000214 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0000073 | Paper_evidence | WBPaper00000214 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Hermaphrodite tail is not effected. | Paper_evidence | WBPaper00000214 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Reference (2) | |||||||||
Method | Substitution_allele |