WormBase Tree Display for Variation: WBVar00143205
expand all nodes | collapse all nodes | view schema
| WBVar00143205 | Name | Public_name | e428 | ||||
|---|---|---|---|---|---|---|---|
| Other_name | CE26205:p.Gln394Ter | ||||||
| Y59A8B.1a.1:c.1180C>T | |||||||
| HGVSg | CHROMOSOME_V:g.17945749G>A | ||||||
| Sequence_details | SMap | S_parent | Sequence | Y59A8B | |||
| Flanking_sequences | acgtcatccacggactcactggagcatatg | agaggaagagaaagaagcaacaggagactg | |||||
| Mapping_target | Y59A8B | ||||||
| Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00006355 | ||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Strain (18) | |||||||
| Laboratory | CB | ||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00001080 | |||||
| Transcript | Y59A8B.1a.1 | VEP_consequence | stop_gained | ||||
| VEP_impact | HIGH | ||||||
| HGVSc | Y59A8B.1a.1:c.1180C>T | ||||||
| HGVSp | CE26205:p.Gln394Ter | ||||||
| cDNA_position | 1345 | ||||||
| CDS_position | 1180 | ||||||
| Protein_position | 394 | ||||||
| Exon_number | 7/13 | ||||||
| Codon_change | Cag/Tag | ||||||
| Amino_acid_change | Q/* | ||||||
| Interactor | WBInteraction000052180 | ||||||
| WBInteraction000052432 | |||||||
| WBInteraction000501500 | |||||||
| Genetics (2) | |||||||
| Description | Phenotype (14) | ||||||
| Phenotype_not_observed (3) | |||||||
| Reference (13) | |||||||
| Remark | The molecular changes given above for this allele were previously attributed to allele y428, owing to a published typo. | Person_evidence | WBPerson421 | ||||
| Method | Substitution_allele |
