WormBase Tree Display for Variation: WBVar00143154
expand all nodes | collapse all nodes | view schema
| WBVar00143154 | Evidence | Paper_evidence | WBPaper00002050 | |
|---|---|---|---|---|
| Name (3) | ||||
| Sequence_details (5) | ||||
| Variation_type | Allele | |||
| Origin (4) | ||||
| Affects (3) | ||||
| Genetics (2) | ||||
| Description (2) | ||||
| Reference (25) | ||||
| Remark | e369 is a coupled mutation. In addition to the curated lesion there is a CAG to TAG substitution with flanking sequences agccgacgattcatgagaatgagccgttgg taatgcaaagtatcagcagacggatgttaa | Paper_evidence | WBPaper00002050 | |
| Method | Substitution_allele |
