WormBase Tree Display for Variation: WBVar00143109
expand all nodes | collapse all nodes | view schema
WBVar00143109 | Evidence | Paper_evidence | WBPaper00004275 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | e314 | |||||
Other_name | CE29050:p.Gly662Glu | ||||||
JC8.10b.1:c.1985G>A | |||||||
JC8.10a.1:c.1967G>A | |||||||
CE28239:p.Gly656Glu | |||||||
HGVSg | CHROMOSOME_IV:g.13265515C>T | ||||||
Sequence_details | SMap | S_parent | Sequence | Y67H2A | |||
Flanking_sequences | ctggaatgggtggagcaactggaaataagg | atccgttgccttccgaatcgtcgtattctc | |||||
Mapping_target | Y67H2A | ||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00004275 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Laboratory | CB | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00006763 | |||||
Transcript | JC8.10b.1 (12) | ||||||
JC8.10a.1 (12) | |||||||
Genetics | Interpolated_map_position | IV | 8.51266 | ||||
Description | Phenotype | WBPhenotype:0000017 | Paper_evidence | WBPaper00004275 | |||
Curator_confirmed | WBPerson712 | ||||||
Remark | Weak allele. unc-26 mutants are resistant to inhibitors of acetylcholinesterase, indicative of a decrease in acetylcholine release. | Paper_evidence | WBPaper00004275 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0000210 | Paper_evidence | WBPaper00004275 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | Weak allele. unc-26 mutants have reduced numbers of enteric muscle contractions, indicative of GABAergic function. | Paper_evidence | WBPaper00004275 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0000229 | Paper_evidence | WBPaper00004275 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | Weak allele. unc-26 mutants resemble mutants lacking the biosynthetic enzyme for acetylcholine encoded by the cha-1 gene; animals are small. | Paper_evidence | WBPaper00004275 | ||||
Curator_confirmed | WBPerson712 | ||||||
Strong allele. unc-26 mutants resemble mutants lacking the biosynthetic enzyme for acetylcholine encoded by the cha-1 gene; animals are small. | Paper_evidence | WBPaper00004275 | |||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0000455 | Paper_evidence | WBPaper00004275 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | Weak allele. unc-26 mutants resemble mutants lacking the biosynthetic enzyme for acetylcholine encoded by the cha-1 gene; animals move backwards with a jerky motion | Paper_evidence | WBPaper00004275 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0000565 | Paper_evidence | WBPaper00004275 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | Weak allele. unc-26 mutants resemble mutants lacking the biosynthetic enzyme for acetylcholine encoded by the cha-1 gene; frequently coil. | Paper_evidence | WBPaper00004275 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0000643 | Paper_evidence | WBPaper00001303 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | Animals showed good mobility throughout its life cycle. | Paper_evidence | WBPaper00001303 | ||||
Curator_confirmed | WBPerson712 | ||||||
Reference | WBPaper00021945 | ||||||
WBPaper00004275 | |||||||
WBPaper00013791 | |||||||
WBPaper00001303 | |||||||
Method | Substitution_allele |