WormBase Tree Display for Variation: WBVar00142964
expand all nodes | collapse all nodes | view schema
WBVar00142964 | Evidence | Person_evidence | WBPerson10095 | |||
---|---|---|---|---|---|---|
Name | Public_name | e107 | ||||
Other_name | F59E12.2.1:c.1310+694C>T | |||||
CE11540:p.Gly127Arg | ||||||
F59E12.12.1:c.379G>A | ||||||
HGVSg | CHROMOSOME_II:g.5651996C>T | |||||
Sequence_details | SMap | S_parent | Sequence | F59E12 | ||
Flanking_sequences | taccatcccgtccatcttctcctggtggtc | tggtggtccagatggtccggttttgcaaga | ||||
Mapping_target | F59E12 | |||||
Type_of_mutation | Substitution | c | t | |||
SeqStatus | Sequenced | |||||
Variation_type | Allele | |||||
Origin | Species | Caenorhabditis elegans | ||||
Strain | WBStrain00051522 | |||||
Laboratory | CB | |||||
Status | Live | |||||
Affects | Gene | WBGene00000252 | ||||
WBGene00006988 | ||||||
Transcript | F59E12.12.1 | VEP_consequence | missense_variant | |||
VEP_impact | MODERATE | |||||
SIFT | 0 | deleterious | ||||
PolyPhen | 1 | probably_damaging | ||||
HGVSc | F59E12.12.1:c.379G>A | |||||
HGVSp | CE11540:p.Gly127Arg | |||||
cDNA_position | 392 | |||||
CDS_position | 379 | |||||
Protein_position | 127 | |||||
Exon_number | 3/4 | |||||
Codon_change | Gga/Aga | |||||
Amino_acid_change | G/R | |||||
F59E12.2.1 | VEP_consequence | intron_variant | ||||
VEP_impact | MODIFIER | |||||
HGVSc | F59E12.2.1:c.1310+694C>T | |||||
Intron_number | 5/8 | |||||
Genetics | Interpolated_map_position | II | -0.987964 | |||
Remark | alt_det = g to a mut_det = G127R | Person_evidence | WBPerson10095 | |||
Curator_confirmed | WBPerson51134 | |||||
Variation information submitted by WBPerson10095 on 2022-02-17_15:42:04 via the Allele submission form. Received data and remarks refer to the negative strand sequence (CDS). | Curator_confirmed | WBPerson51134 | ||||
Method | Substitution_allele |