WormBase Tree Display for Variation: WBVar00142949
expand all nodes | collapse all nodes | view schema
| WBVar00142949 | Name (3) | ||||||||
|---|---|---|---|---|---|---|---|---|---|
| Sequence_details | SMap | S_parent | Sequence | F14D12 | |||||
| Flanking_sequences | aagagattctatcaaaagattccgtgacagtcg | tgtcgatgctgtcgtttatttccgaatttc | |||||||
| Mapping_target | F14D12 | ||||||||
| Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00002482 | ||||
| SeqStatus | Sequenced | ||||||||
| Variation_type | Allele | ||||||||
| Origin | Species | Caenorhabditis elegans | |||||||
| Strain | WBStrain00004092 | ||||||||
| WBStrain00004463 | |||||||||
| Laboratory | CB | ||||||||
| Status | Live | ||||||||
| Affects | Gene | WBGene00003166 | |||||||
| Transcript (17) | |||||||||
| Genetics | Interpolated_map_position | X | -4.6377 | ||||||
| Mapping_data | In_multi_point | 415 | |||||||
| 618 | |||||||||
| 731 | |||||||||
| 732 | |||||||||
| In_pos_neg_data | 940 | ||||||||
| 1832 | |||||||||
| Description | Phenotype | WBPhenotype:0000247 | Paper_evidence | WBPaper00000214 | |||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | Mutants behave like WT in a Na+ gradient assay; however, mutants are 15% responsive to Na+ in a behavior orientation assay. WT worms are 95% responsive (based on sustained distance from attractant). | Paper_evidence | WBPaper00000214 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0000254 | Paper_evidence | WBPaper00000214 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | Mutants are 5% responsive to Cl- in behavior orientation assay (based on sustained distance from attractant), WT are 70% responsive. | Paper_evidence | WBPaper00000214 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0000456 | Paper_evidence | WBPaper00000214 | |||||||
| WBPaper00000502 | |||||||||
| Person_evidence | WBPerson261 | ||||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | weak variable Mec | Paper_evidence | WBPaper00000502 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Penetrance | Incomplete | Paper_evidence | WBPaper00000502 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Recessive | Paper_evidence | WBPaper00000502 | |||||||
| Person_evidence | WBPerson261 | ||||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0001213 | Paper_evidence | WBPaper00000214 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | Mutants are lethargic in bacteria but active on a bare plate. | Paper_evidence | WBPaper00000214 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0001438 | Paper_evidence | WBPaper00001786 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Remark | Defective in chemotaxis to volatile odorants including benzaldehyde, 2-butanone and isoamyl alcohol (Data not shown). | Paper_evidence | WBPaper00001786 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00001786 | ||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Phenotype_not_observed (6) | |||||||||
| Reference (15) | |||||||||
| Method | Substitution_allele |
