WormBase Tree Display for Variation: WBVar00142941
expand all nodes | collapse all nodes | view schema
WBVar00142941 | Evidence | Paper_evidence | WBPaper00027361 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | e61 | |||||
Other_name | e61sd | ||||||
F27C1.8.1:c.607G>T | |||||||
CE09720:p.Gly203Ter | |||||||
HGVSg | CHROMOSOME_I:g.5432445C>A | ||||||
Sequence_details | SMap | S_parent | Sequence | F27C1 | |||
Flanking_sequences | ccaggacttgctggaccaccaggacgcgat | gacttaccggaaagggacaaccaggagtcg | |||||
Mapping_target | F27C1 | ||||||
Type_of_mutation | Substitution | g | t | Paper_evidence | WBPaper00027361 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin (4) | |||||||
Affects (3) | |||||||
Genetics | Interpolated_map_position | I | -0.0011509 | ||||
Mapping_data | In_2_point (165) | ||||||
In_multi_point (349) | |||||||
In_pos_neg_data (72) | |||||||
Description (2) | |||||||
Reference (45) | |||||||
Remark | Variation stub/paper connection generated from the May 2021 NN VFP dataset. | ||||||
Created by WBPerson51134 from the NN_VFP_triage_pipeline | |||||||
Method | Substitution_allele |