WormBase Tree Display for Variation: WBVar00142928
expand all nodes | collapse all nodes | view schema
WBVar00142928 | Name | Public_name | e41 | ||||
---|---|---|---|---|---|---|---|
Other_name (2) | |||||||
HGVSg | CHROMOSOME_X:g.10511250G>A | ||||||
Sequence_details | SMap | S_parent | Sequence | F14F3 | |||
Flanking_sequences | aatatctgcaacaacgaaacaataccaagc | tgagtatttaacttgaatgtttgaaacttt | |||||
Mapping_target | F14F3 | ||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00002236 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin (3) | |||||||
Affects | Gene | WBGene00006870 | |||||
Transcript | F14F3.1a.1 | VEP_consequence | splice_donor_variant | ||||
VEP_impact | HIGH | ||||||
HGVSc | F14F3.1a.1:c.360+1G>A | ||||||
Intron_number | 6/13 | ||||||
F14F3.1a.2 | VEP_consequence | splice_donor_variant | |||||
VEP_impact | HIGH | ||||||
HGVSc | F14F3.1a.2:c.360+1G>A | ||||||
Intron_number | 5/12 | ||||||
Isolation | Mutagen | EMS | Paper_evidence | WBPaper00002236 | |||
Genetics | Interpolated_map_position | X | 2.22424 | ||||
Mapping_data | In_multi_point | 3020 | |||||
Reference | WBPaper00014314 | ||||||
WBPaper00021795 | |||||||
Remark | The exon numbering in this paper refers to a combination of all isoforms. Exon 5 corresponds to exon 4 of isoform F14F3.1a | Paper_evidence | WBPaper00024640 | ||||
Method | Substitution_allele |