WormBase Tree Display for Variation: WBVar00142132
expand all nodes | collapse all nodes | view schema
| WBVar00142132 | Evidence | Paper_evidence | WBPaper00036066 | ||||
|---|---|---|---|---|---|---|---|
| Name | Public_name | cxTi9515 | |||||
| Sequence_details | SMap | S_parent | Sequence | C09E8 | |||
| Flanking_sequences | ccacttccacatctgtccgcacctt | atctcgtcgcccatttattgctgct | |||||
| Mapping_target | C09E8 | ||||||
| Type_of_mutation | Insertion | ||||||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Transposon_insertion | Mos | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Strain | WBStrain00025641 | ||||||
| Laboratory | LS | ||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00020835 | |||||
| WBGene00015646 | |||||||
| Transcript | C09E8.3.1 | ||||||
| T27A1.3b.1 | |||||||
| Description | Phenotype | WBPhenotype:0000137 | Paper_evidence | WBPaper00036066 | |||
| Curator_confirmed | WBPerson2021 | ||||||
| Remark | The mutation severely decreased the level of mlt-10 expression | Paper_evidence | WBPaper00036066 | ||||
| Curator_confirmed | WBPerson2021 | ||||||
| Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00036066 | ||||
| Curator_confirmed | WBPerson2021 | ||||||
| Reference | WBPaper00036066 | ||||||
| Remark | [20051215 ls] the TA insertion site may be +/- 10bp from this location | ||||||
| [20051215 ls] the left side of Mos is facing the right of the sequence | |||||||
| For further information and strain requests please visit http://ums3421.univ-lyon1.fr/ | |||||||
| Method | NemaGENETAG_consortium_allele |
