WormBase Tree Display for Variation: WBVar00095130
expand all nodes | collapse all nodes | view schema
WBVar00095130 | Evidence | Paper_evidence | WBPaper00004715 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | p813 | |||||||
Other_name | CE28361:p.Gln479Ter | ||||||||
Y41G9A.1.1:c.1435C>T | |||||||||
HGVSg | CHROMOSOME_X:g.2988002C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | Y41G9A | |||||
Flanking_sequences | gaccgctataatgcgcatgctcaagtcaac | aaggcaacattgcgtacatgaacggcgatt | |||||||
Mapping_target | Y41G9A | ||||||||
Type_of_mutation | Substitution | c | t | ||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00030797 | ||||||||
Laboratory | PR | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00003885 | |||||||
Transcript | Y41G9A.1.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | Y41G9A.1.1:c.1435C>T | ||||||||
HGVSp | CE28361:p.Gln479Ter | ||||||||
cDNA_position | 1450 | ||||||||
CDS_position | 1435 | ||||||||
Protein_position | 479 | ||||||||
Exon_number | 11/17 | ||||||||
Codon_change | Caa/Taa | ||||||||
Amino_acid_change | Q/* | ||||||||
Interactor (2) | |||||||||
Genetics | Interpolated_map_position | X | -12.6622 | ||||||
Mapping_data | In_2_point | 376 | |||||||
377 | |||||||||
3384 | |||||||||
In_multi_point | 1209 | ||||||||
1210 | |||||||||
1211 | |||||||||
1212 | |||||||||
In_pos_neg_data | 3180 | ||||||||
5450 | |||||||||
Description | Phenotype (23) | ||||||||
Phenotype_not_observed | WBPhenotype:0000067 | Paper_evidence | WBPaper00003582 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | mutants showed a normal feeding inhibition response when exposed to either cadmium or captan | Paper_evidence | WBPaper00003582 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000315 | Paper_evidence | WBPaper00000932 | |||||||
WBPaper00000082 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals showed normal sensitivity to light head and tail tapping with a human eyelash. | Paper_evidence | WBPaper00000082 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000478 | Paper_evidence | WBPaper00000932 | |||||||
WBPaper00000082 | |||||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals were able to track isothermally. | Paper_evidence | WBPaper00000082 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
normal thermotaxis | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000643 | Paper_evidence | WBPaper00000082 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals moved normally. | Paper_evidence | WBPaper00000082 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001015 | Paper_evidence | WBPaper00000082 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals did not display any major developmental defects compared to N2 animals. | Paper_evidence | WBPaper00000082 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001741 | Paper_evidence | WBPaper00032000 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Males displayed no spontaneous spicule-muscle seizures in the presence or absence of food. | Paper_evidence | WBPaper00032000 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005826 | PATO:0000460 | Paper_evidence | WBPaper00032000 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0005312 | PATO:0000460 | Paper_evidence | WBPaper00032000 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00032000 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | To effect food deprivation animals were moved to plates with no food (E. coli) or fed inedible bacteria (aztreonam-treated E. coli). | Paper_evidence | WBPaper00032000 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001765 | Paper_evidence | WBPaper00031936 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Mutants respond normally to CO2 | Paper_evidence | WBPaper00031936 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00031936 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | 10% CO2 | Paper_evidence | WBPaper00031936 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference (20) | |||||||||
Remark | Created by WBPerson51134 from the NN_VFP_triage_pipeline | ||||||||
Variation stub/paper connection generated from the May 2021 NN VFP dataset. | |||||||||
Method | Substitution_allele |