WormBase Tree Display for Variation: WBVar00094781
expand all nodes | collapse all nodes | view schema
WBVar00094781 | Evidence | Person_evidence | WBPerson1705 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | ot16 | ||||||
Other_name | CE36681:p.Gly610Glu | |||||||
B0285.5.3:c.1829G>A | ||||||||
B0285.5.2:c.1829G>A | ||||||||
B0285.5.1:c.1829G>A | ||||||||
HGVSg | CHROMOSOME_III:g.4348971G>A | |||||||
Sequence_details | SMap | S_parent | Sequence | B0285 | ||||
Flanking_sequences | ttgagtaaaacagcagatcgatggattggatacgcgtatg | aaaacgggcaaaacataattaattgttagtaagaaattt | ||||||
Mapping_target | B0285 | |||||||
Type_of_mutation | Substitution | g | a | |||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | OH | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00002003 | ||||||
Transcript | B0285.5.1 (12) | |||||||
B0285.5.3 (12) | ||||||||
B0285.5.2 (12) | ||||||||
Interactor | WBInteraction000052327 | |||||||
Isolation | Mutagen | EMS | ||||||
Forward_genetics | clonal F1 modifier screen | |||||||
Genetics | Interpolated_map_position | III | -3.1845 | |||||
Description | Phenotype (5) | |||||||
Phenotype_not_observed | WBPhenotype:0000062 | Paper_evidence | WBPaper00006471 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | Non-lethal | Paper_evidence | WBPaper00006471 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00006471 | |||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0000470 | Paper_evidence | WBPaper00006471 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | No defects in HSN migration | Paper_evidence | WBPaper00006471 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00006471 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Phenotype_assay | Genotype | mgIs71 | Paper_evidence | WBPaper00006471 | ||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0000688 | Paper_evidence | WBPaper00006471 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | Non-sterile | Paper_evidence | WBPaper00006471 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00006471 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Reference | WBPaper00006471 | |||||||
Remark | The glycine residue that is changed is perfectly conserved and the mutation introduces a negative charge in the positively charged C-terminus. The C-terminus is indispensible for enzymatic activity | Person_evidence | WBPerson1705 | |||||
Genotype is "mgIs18IV; otIs35X" | Person_evidence | WBPerson1705 | ||||||
Method | Substitution_allele |