WormBase Tree Display for Variation: WBVar00094754
expand all nodes | collapse all nodes | view schema
WBVar00094754 | Evidence | Paper_evidence | WBPaper00032405 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name (3) | |||||||||
Sequence_details | SMap | S_parent | Sequence | K08E3 | |||||
Flanking_sequences | gcagcagttattcattgtgtggttgccctg | aggctcgtggactcacgcaggaaggtattt | |||||||
Mapping_target | K08E3 | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00032405 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00007362 | ||||||||
WBStrain00026734 | |||||||||
Laboratory | EU | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00000875 | |||||||
Transcript | K08E3.6.1 (12) | ||||||||
Interactor (12) | |||||||||
Isolation | Mutagen | ENU | |||||||
Genetics | Interpolated_map_position | III | 21.5095 | ||||||
Description | Phenotype_not_observed | WBPhenotype:0000812 | Paper_evidence | WBPaper00061728 | |||||
Curator_confirmed | WBPerson557 | ||||||||
Remark | Authors found that the primordial germ line organization in cyk-4(or749ts) L1-stage larvae maintained at restrictive temperature (26C) for 12h was no different than control. Authors state these mutants are largely ineffective to perturb actomyosin function in the L1-stage primordial germ line. | Paper_evidence | WBPaper00061728 | ||||||
Curator_confirmed | WBPerson557 | ||||||||
EQ_annotations | Life_stage | WBls:0000024 | PATO:0000460 | Paper_evidence | WBPaper00061728 | ||||
Curator_confirmed | WBPerson557 | ||||||||
Temperature_sensitive | Heat_sensitive | Paper_evidence | WBPaper00061728 | ||||||
Curator_confirmed | WBPerson557 | ||||||||
Phenotype_assay | Treatment | L1-stage larvae were upshifted at 26C for 12h, this is the restrictive temperature for these temperature-sensitive mutants. | Paper_evidence | WBPaper00061728 | |||||
Curator_confirmed | WBPerson557 | ||||||||
Reference | WBPaper00032405 | ||||||||
WBPaper00045580 | |||||||||
WBPaper00061728 | |||||||||
Method | Substitution_allele |