WormBase Tree Display for Variation: WBVar00094693
expand all nodes | collapse all nodes | view schema
WBVar00094693 | Evidence | Paper_evidence | WBPaper00013411 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | or188 | |||||
Other_name | F32H2.3.1:c.1844G>A | ||||||
CE09878:p.Gly615Glu | |||||||
HGVSg | CHROMOSOME_I:g.8967814C>T | ||||||
Sequence_details | SMap | S_parent | Sequence | F32H2 | |||
Flanking_sequences | gaatctcttttaagatcagcaactctgcag | aacaaggtaggctaaatagacgacgcttac | |||||
Mapping_target | F32H2 | ||||||
Type_of_mutation | Substitution | g | a | ||||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Laboratory | EU | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00004953 | |||||
Transcript | F32H2.3.1 (12) | ||||||
Genetics | Interpolated_map_position | I | 3.33638 | ||||
Description | Phenotype | WBPhenotype:0000050 | Paper_evidence | WBPaper00038325 | |||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0000679 | Paper_evidence | WBPaper00040172 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | GPR-1 at the P2-EMS contact in nocodazole treated embryos accumulated normally, but then the level failed to decrease at the time when spindle alignment would normally occur. Instead, the mCherry::GPR-1 level continued to increase at a linear rate similar to that before spindle alignment. | Paper_evidence | WBPaper00040172 | ||||
Curator_confirmed | WBPerson712 | ||||||
Reference | WBPaper00038325 | ||||||
WBPaper00040172 | |||||||
WBPaper00013411 | |||||||
Method | Substitution_allele |