WormBase Tree Display for Variation: WBVar00093955
expand all nodes | collapse all nodes | view schema
WBVar00093955 | Evidence | Paper_evidence | WBPaper00037686 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | ok2860 | |||||
Other_name | CE44998:p.Asn126_Ala327delinsGlnThr | ||||||
C50F4.14b.1:c.375_979delinsTCAAA | |||||||
C50F4.14a.1:c.417_1021delinsTCAAA | |||||||
CE30910:p.Asn140_Ala341delinsGlnThr | |||||||
HGVSg | CHROMOSOME_V:g.9547839_9548560delinsTTTGA | ||||||
Sequence_details | SMap | S_parent | Sequence | C50F4 | |||
Flanking_sequences | gcttcactttgtcagattttgcctcgctag | aaaacggtcgttaaactacgtccaacatag | |||||
Mapping_target | C50F4 | ||||||
Type_of_mutation | Insertion | TTTGA | |||||
Deletion | |||||||
PCR_product | ok2860_external | ||||||
ok2860_internal | |||||||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain | WBStrain00032828 | ||||||
Laboratory | RB | ||||||
Person | WBPerson46 | ||||||
KO_consortium_allele | |||||||
Status | Live | ||||||
Affects | Gene | WBGene00008237 | |||||
Transcript | C50F4.14b.1 (11) | ||||||
C50F4.14a.1 (11) | |||||||
Isolation | Mutagen | EMS | |||||
Description | Phenotype_not_observed | WBPhenotype:0000520 | Paper_evidence | WBPaper00037686 | |||
Curator_confirmed | WBPerson712 | ||||||
Remark | Animals appeared grossly normal. | Paper_evidence | WBPaper00037686 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0001413 | Paper_evidence | WBPaper00037686 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | Animals exhibited a grossly normal response to M. nematophilum exposure. | Paper_evidence | WBPaper00037686 | ||||
Curator_confirmed | WBPerson712 | ||||||
Reference | WBPaper00037686 | ||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||
Method | KO_consortium_allele |